Miyakogusa Predicted Gene

Lj1g3v4564980.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v4564980.1 Non Chatacterized Hit- tr|I1NA06|I1NA06_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,63.78,0,Multidrug
resistance efflux transporter EmrE,NULL; EamA,Drug/metabolite
transporter; FAMILY NOT
NAME,NODE_60608_length_1588_cov_8.716624.path2.1
         (978 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC66586 similar to UniRef100_Q8LE45 Cluster: Nodulin-li...   168   4e-41
gnl|LJGI|TC64276 similar to UniRef100_Q8LE45 Cluster: Nodulin-li...   155   6e-37
gnl|LJGI|GO027891 similar to UniRef100_A7PSY6 Cluster: Chromosom...    88   1e-16
gnl|LJGI|TC79270 similar to UniRef100_Q8LE45 Cluster: Nodulin-li...    86   5e-16

>gnl|LJGI|TC66586 similar to UniRef100_Q8LE45 Cluster: Nodulin-like protein; n=1;
           Arabidopsis thaliana|Rep: Nodulin-like protein -
           Arabidopsis thaliana (Mouse-ear cress), partial (50%)
          Length = 738

 Score =  168 bits (85), Expect = 4e-41
 Identities = 196/233 (84%)
 Strand = Plus / Plus

                                                                       
Query: 190 gagaagaacgtaaggcccaagatgacatttccaatctttataaagatagtggccctcggc 249
           |||||||| ||||||||||||||||||||  |||| ||||| ||||| ||||| ||| ||
Sbjct: 248 gagaagaaagtaaggcccaagatgacattgtcaatttttatgaagattgtggcgctcagc 307

                                                                       
Query: 250 ttgcttgagccagttattacccgaaatttttatttttctggaatgaagtacacaacggca 309
             ||| ||||||||||||  ||  ||||| |||||||  || |||||||||||||| |||
Sbjct: 308 gcgctagagccagttattgaccagaatttgtattttttgggcatgaagtacacaactgca 367

                                                                       
Query: 310 acttatgctgttgccatggccaatatccttcctgccaccacctttatcatggcttgcatt 369
           |||| ||||||||||||| |||| |||||||||||||  ||||||||| | || ||||||
Sbjct: 368 acttttgctgttgccatgaccaacatccttcctgccattacctttatctttgcctgcatt 427

                                                                
Query: 370 cttaagcttgagatgataaaatttagtagtatacgtggtcaagcaaaggtggt 422
           |||| |||||||| ||||||| | |  | ||||||| | ||||||||||||||
Sbjct: 428 cttaggcttgagaagataaaaatgaaaactatacgtagccaagcaaaggtggt 480


>gnl|LJGI|TC64276 similar to UniRef100_Q8LE45 Cluster: Nodulin-like protein; n=1;
           Arabidopsis thaliana|Rep: Nodulin-like protein -
           Arabidopsis thaliana (Mouse-ear cress), partial (53%)
          Length = 830

 Score =  155 bits (78), Expect = 6e-37
 Identities = 243/298 (81%)
 Strand = Plus / Plus

                                                                       
Query: 200 taaggcccaagatgacatttccaatctttataaagatagtggccctcggcttgcttgagc 259
           ||||||| |||||||||||| |||||||| | |||||||||   ||  ||||| | ||||
Sbjct: 287 taaggccgaagatgacattttcaatctttgtgaagatagtgttactgagcttgttagagc 346

                                                                       
Query: 260 cagttattacccgaaatttttatttttctggaatgaagtacacaacggcaacttatgctg 319
           ||||||||   |  ||| | |||| ||  ||||||||||||||||| ||||| | ||| |
Sbjct: 347 cagttattgatcagaatctgtattatttgggaatgaagtacacaacagcaacctttgcag 406

                                                                       
Query: 320 ttgccatggccaatatccttcctgccaccacctttatcatggcttgcattcttaagcttg 379
           || |||||  ||||||||||||||||| ||| ||  ||||||||| |||||||||||| |
Sbjct: 407 tttccatgtacaatatccttcctgccatcactttcctcatggcttacattcttaagctag 466

                                                                       
Query: 380 agatgataaaatttagtagtatacgtggtcaagcaaaggtggttgggactttagtctcta 439
           ||| ||||||| | |  ||||||||| |||||||||||||| |||||||||||| | || 
Sbjct: 467 agaagataaaaataaaaagtatacgtagtcaagcaaaggtgtttgggactttagccactg 526

                                                                     
Query: 440 ttacaggtgcattggtcatgacacttattaaaggcccggtgcttaagcttttcgggac 497
           || |||||||  |||| |||||||| || |||||||| |  ||| ||||||| |||||
Sbjct: 527 ttgcaggtgccatggtgatgacactaataaaaggccctgaacttgagctttttgggac 584


>gnl|LJGI|GO027891 similar to UniRef100_A7PSY6 Cluster: Chromosome chr8 scaffold_29,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr8 scaffold_29, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (29%)
          Length = 778

 Score = 87.7 bits (44), Expect = 1e-16
 Identities = 149/184 (80%)
 Strand = Plus / Minus

                                                                       
Query: 777 tgtctacagtggcttagtttgctcaggaatggtttattacgttcaaggaatagtgatgaa 836
           ||||||| ||||| |||||||||| ||||||  ||||||| | ||||||  |||||||||
Sbjct: 655 tgtctacggtggcatagtttgctctggaatgacttattacatccaaggagcagtgatgaa 596

                                                                       
Query: 837 atatagaggcccagtgtttgtaacatcttttgagccactgtgcatgatctttgtggctat 896
           ||| | ||||||||| ||||||||| | ||    || || ||||||||| ||||||||||
Sbjct: 595 atacaaaggcccagtctttgtaacaacattcagtcctctatgcatgatcattgtggctat 536

                                                                       
Query: 897 cttgggatccatctttttggcggagcaactgactcttggaaggatgatcggcgccattgt 956
             |||| ||  |  ||||||| |||||| ||  |||||||||| |||| || ||||||||
Sbjct: 535 actgggctcttttattttggctgagcaaatgtatcttggaagggtgattggagccattgt 476

               
Query: 957 catt 960
           ||||
Sbjct: 475 catt 472


>gnl|LJGI|TC79270 similar to UniRef100_Q8LE45 Cluster: Nodulin-like protein; n=1;
           Arabidopsis thaliana|Rep: Nodulin-like protein -
           Arabidopsis thaliana (Mouse-ear cress), partial (22%)
          Length = 335

 Score = 85.7 bits (43), Expect = 5e-16
 Identities = 100/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 193 aagaacgtaaggcccaagatgacatttccaatctttataaagatagtggccctcggcttg 252
           |||||| ||||||| |||||||||||| |||||||| | ||||||||||| ||  |||||
Sbjct: 196 aagaacataaggccaaagatgacattttcaatctttgtgaagatagtggcactgagcttg 255

                                                                      
Query: 253 cttgagccagttattacccgaaatttttatttttctggaatgaagtacacaacggcaac 311
            | |||||||||||| | |  ||| | |||||||  ||||||||||||||||| |||||
Sbjct: 256 ttagagccagttattgctcagaatctgtattttttgggaatgaagtacacaacagcaac 314