Miyakogusa Predicted Gene
- Lj1g3v4564980.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v4564980.1 Non Chatacterized Hit- tr|I1NA06|I1NA06_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,63.78,0,Multidrug
resistance efflux transporter EmrE,NULL; EamA,Drug/metabolite
transporter; FAMILY NOT
NAME,NODE_60608_length_1588_cov_8.716624.path2.1
(978 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC66586 similar to UniRef100_Q8LE45 Cluster: Nodulin-li... 168 4e-41
gnl|LJGI|TC64276 similar to UniRef100_Q8LE45 Cluster: Nodulin-li... 155 6e-37
gnl|LJGI|GO027891 similar to UniRef100_A7PSY6 Cluster: Chromosom... 88 1e-16
gnl|LJGI|TC79270 similar to UniRef100_Q8LE45 Cluster: Nodulin-li... 86 5e-16
>gnl|LJGI|TC66586 similar to UniRef100_Q8LE45 Cluster: Nodulin-like protein; n=1;
Arabidopsis thaliana|Rep: Nodulin-like protein -
Arabidopsis thaliana (Mouse-ear cress), partial (50%)
Length = 738
Score = 168 bits (85), Expect = 4e-41
Identities = 196/233 (84%)
Strand = Plus / Plus
Query: 190 gagaagaacgtaaggcccaagatgacatttccaatctttataaagatagtggccctcggc 249
|||||||| |||||||||||||||||||| |||| ||||| ||||| ||||| ||| ||
Sbjct: 248 gagaagaaagtaaggcccaagatgacattgtcaatttttatgaagattgtggcgctcagc 307
Query: 250 ttgcttgagccagttattacccgaaatttttatttttctggaatgaagtacacaacggca 309
||| |||||||||||| || ||||| ||||||| || |||||||||||||| |||
Sbjct: 308 gcgctagagccagttattgaccagaatttgtattttttgggcatgaagtacacaactgca 367
Query: 310 acttatgctgttgccatggccaatatccttcctgccaccacctttatcatggcttgcatt 369
|||| ||||||||||||| |||| ||||||||||||| ||||||||| | || ||||||
Sbjct: 368 acttttgctgttgccatgaccaacatccttcctgccattacctttatctttgcctgcatt 427
Query: 370 cttaagcttgagatgataaaatttagtagtatacgtggtcaagcaaaggtggt 422
|||| |||||||| ||||||| | | | ||||||| | ||||||||||||||
Sbjct: 428 cttaggcttgagaagataaaaatgaaaactatacgtagccaagcaaaggtggt 480
>gnl|LJGI|TC64276 similar to UniRef100_Q8LE45 Cluster: Nodulin-like protein; n=1;
Arabidopsis thaliana|Rep: Nodulin-like protein -
Arabidopsis thaliana (Mouse-ear cress), partial (53%)
Length = 830
Score = 155 bits (78), Expect = 6e-37
Identities = 243/298 (81%)
Strand = Plus / Plus
Query: 200 taaggcccaagatgacatttccaatctttataaagatagtggccctcggcttgcttgagc 259
||||||| |||||||||||| |||||||| | ||||||||| || ||||| | ||||
Sbjct: 287 taaggccgaagatgacattttcaatctttgtgaagatagtgttactgagcttgttagagc 346
Query: 260 cagttattacccgaaatttttatttttctggaatgaagtacacaacggcaacttatgctg 319
|||||||| | ||| | |||| || ||||||||||||||||| ||||| | ||| |
Sbjct: 347 cagttattgatcagaatctgtattatttgggaatgaagtacacaacagcaacctttgcag 406
Query: 320 ttgccatggccaatatccttcctgccaccacctttatcatggcttgcattcttaagcttg 379
|| ||||| ||||||||||||||||| ||| || ||||||||| |||||||||||| |
Sbjct: 407 tttccatgtacaatatccttcctgccatcactttcctcatggcttacattcttaagctag 466
Query: 380 agatgataaaatttagtagtatacgtggtcaagcaaaggtggttgggactttagtctcta 439
||| ||||||| | | ||||||||| |||||||||||||| |||||||||||| | ||
Sbjct: 467 agaagataaaaataaaaagtatacgtagtcaagcaaaggtgtttgggactttagccactg 526
Query: 440 ttacaggtgcattggtcatgacacttattaaaggcccggtgcttaagcttttcgggac 497
|| ||||||| |||| |||||||| || |||||||| | ||| ||||||| |||||
Sbjct: 527 ttgcaggtgccatggtgatgacactaataaaaggccctgaacttgagctttttgggac 584
>gnl|LJGI|GO027891 similar to UniRef100_A7PSY6 Cluster: Chromosome chr8 scaffold_29,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr8 scaffold_29, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (29%)
Length = 778
Score = 87.7 bits (44), Expect = 1e-16
Identities = 149/184 (80%)
Strand = Plus / Minus
Query: 777 tgtctacagtggcttagtttgctcaggaatggtttattacgttcaaggaatagtgatgaa 836
||||||| ||||| |||||||||| |||||| ||||||| | |||||| |||||||||
Sbjct: 655 tgtctacggtggcatagtttgctctggaatgacttattacatccaaggagcagtgatgaa 596
Query: 837 atatagaggcccagtgtttgtaacatcttttgagccactgtgcatgatctttgtggctat 896
||| | ||||||||| ||||||||| | || || || ||||||||| ||||||||||
Sbjct: 595 atacaaaggcccagtctttgtaacaacattcagtcctctatgcatgatcattgtggctat 536
Query: 897 cttgggatccatctttttggcggagcaactgactcttggaaggatgatcggcgccattgt 956
|||| || | ||||||| |||||| || |||||||||| |||| || ||||||||
Sbjct: 535 actgggctcttttattttggctgagcaaatgtatcttggaagggtgattggagccattgt 476
Query: 957 catt 960
||||
Sbjct: 475 catt 472
>gnl|LJGI|TC79270 similar to UniRef100_Q8LE45 Cluster: Nodulin-like protein; n=1;
Arabidopsis thaliana|Rep: Nodulin-like protein -
Arabidopsis thaliana (Mouse-ear cress), partial (22%)
Length = 335
Score = 85.7 bits (43), Expect = 5e-16
Identities = 100/119 (84%)
Strand = Plus / Plus
Query: 193 aagaacgtaaggcccaagatgacatttccaatctttataaagatagtggccctcggcttg 252
|||||| ||||||| |||||||||||| |||||||| | ||||||||||| || |||||
Sbjct: 196 aagaacataaggccaaagatgacattttcaatctttgtgaagatagtggcactgagcttg 255
Query: 253 cttgagccagttattacccgaaatttttatttttctggaatgaagtacacaacggcaac 311
| |||||||||||| | | ||| | ||||||| ||||||||||||||||| |||||
Sbjct: 256 ttagagccagttattgctcagaatctgtattttttgggaatgaagtacacaacagcaac 314