Miyakogusa Predicted Gene

Lj1g3v4551240.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v4551240.1 Non Chatacterized Hit- tr|I1N9Z5|I1N9Z5_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,75,0,Putative GTP-ase
activating proteins for the,Arf GTPase activating protein; ArfGap,Arf
GTPase activa,CUFF.32637.1
         (1392 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC82355 similar to UniRef100_Q2HVU4 Cluster: Arf GTPase...   868   0.0  
gnl|LJGI|TC75091 similar to UniRef100_Q2HVU4 Cluster: Arf GTPase...   678   0.0  
gnl|LJGI|TC78145 homologue to UniRef100_Q2HVU4 Cluster: Arf GTPa...   615   e-175
gnl|LJGI|TC60779 similar to UniRef100_Q2HVU4 Cluster: Arf GTPase...   276   4e-73
gnl|LJGI|TC78740 weakly similar to UniRef100_A7PNJ6 Cluster: Chr...    90   4e-17
gnl|LJGI|TC74350 similar to UniRef100_Q2HVU4 Cluster: Arf GTPase...    90   4e-17
gnl|LJGI|TC63472 weakly similar to UniRef100_Q2HVU4 Cluster: Arf...    90   4e-17

>gnl|LJGI|TC82355 similar to UniRef100_Q2HVU4 Cluster: Arf GTPase activating protein;
           n=1; Medicago truncatula|Rep: Arf GTPase activating
           protein - Medicago truncatula (Barrel medic), partial
           (33%)
          Length = 438

 Score =  868 bits (438), Expect = 0.0
 Identities = 438/438 (100%)
 Strand = Plus / Plus

                                                                       
Query: 485 ggcggaatcagtctactggagatgttttggggtttggtggtggaggcggagtggttccgt 544
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggcggaatcagtctactggagatgttttggggtttggtggtggaggcggagtggttccgt 60

                                                                       
Query: 545 cgaggtcgaagtcgacggaggatattcacacgcggacgcagttggaggcatctgctgcta 604
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  cgaggtcgaagtcgacggaggatattcacacgcggacgcagttggaggcatctgctgcta 120

                                                                       
Query: 605 acaaggagagcttcttcgcgaggaagatggcggagaatgagtctaggccggatgggcttc 664
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 acaaggagagcttcttcgcgaggaagatggcggagaatgagtctaggccggatgggcttc 180

                                                                       
Query: 665 cgccgtcgcagggtggcaagtatgttggatttgggtctagtcctgcccctgctcaaagga 724
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 cgccgtcgcagggtggcaagtatgttggatttgggtctagtcctgcccctgctcaaagga 240

                                                                       
Query: 725 gcagcaatcctcaaaacgattatttcgatgtcgtttcgcagggaattggtaaattatcat 784
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 gcagcaatcctcaaaacgattatttcgatgtcgtttcgcagggaattggtaaattatcat 300

                                                                       
Query: 785 tagttgttcaggcaggaaccaaagagttaacttccaaggtaaaggagggtggttatgatt 844
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301 tagttgttcaggcaggaaccaaagagttaacttccaaggtaaaggagggtggttatgatt 360

                                                                       
Query: 845 acaaagtcaatgaaactgtcaatattgtctctcagaagacatcggagattggacaaagga 904
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 361 acaaagtcaatgaaactgtcaatattgtctctcagaagacatcggagattggacaaagga 420

                             
Query: 905 catggggtataatgaaag 922
           ||||||||||||||||||
Sbjct: 421 catggggtataatgaaag 438


>gnl|LJGI|TC75091 similar to UniRef100_Q2HVU4 Cluster: Arf GTPase activating protein;
            n=1; Medicago truncatula|Rep: Arf GTPase activating
            protein - Medicago truncatula (Barrel medic), partial
            (19%)
          Length = 764

 Score =  678 bits (342), Expect = 0.0
 Identities = 345/346 (99%)
 Strand = Plus / Plus

                                                                        
Query: 1047 gaataaaggttggaattcttctatcagagaaggacagccttcatcaggtggacaaactaa 1106
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2    gaataaaggttggaattcttctatcagagaaggacagccttcatcaggtggacaaactaa 61

                                                                        
Query: 1107 tacttactcaagttcttgggatgattgggaccataaagattccacaaagggaggtccagc 1166
            |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 62   tacttactcaagttcttgggatgattgggaccatgaagattccacaaagggaggtccagc 121

                                                                        
Query: 1167 tagaggatcagctcctcagtcatccaatgggaggaacaactcaagttcttgggatgattg 1226
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 122  tagaggatcagctcctcagtcatccaatgggaggaacaactcaagttcttgggatgattg 181

                                                                        
Query: 1227 ggaccacaaggatgctaggaaggtagaaccagctaaaggatcatctccccataataatga 1286
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 182  ggaccacaaggatgctaggaaggtagaaccagctaaaggatcatctccccataataatga 241

                                                                        
Query: 1287 tagttgggctggctgggatgatgccaaagatgatgacttcgataataaagctagtgatca 1346
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 242  tagttgggctggctgggatgatgccaaagatgatgacttcgataataaagctagtgatca 301

                                                          
Query: 1347 taatggaacatcaggttctggctggacaggaggaggctttctctaa 1392
            ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 302  taatggaacatcaggttctggctggacaggaggaggctttctctaa 347


>gnl|LJGI|TC78145 homologue to UniRef100_Q2HVU4 Cluster: Arf GTPase activating
           protein; n=1; Medicago truncatula|Rep: Arf GTPase
           activating protein - Medicago truncatula (Barrel medic),
           partial (25%)
          Length = 481

 Score =  615 bits (310), Expect = e-175
 Identities = 327/335 (97%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcggcgtcacggcggctccgggatctccaatccgagccctccaacaagatctgcgtc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 147 atggcggcgtcacggcggctccgggatctccaatccgagccctccaacaagatctgcgtc 206

                                                                       
Query: 61  gactgctcccnnnnnnncccccaatgggcctccgtctcctacggcgtcttcatgtgcctc 120
           ||||||||||       |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 207 gactgctcccaaaaaaacccccaatgggcctccgtctcctacggcgtcttcatgtgcctc 266

                                                                       
Query: 121 gaatgctccggcaaacaccgcggcctcggtgtccacatctccttcgtccgatccgtcacc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 267 gaatgctccggcaaacaccgcggcctcggtgtccacatctccttcgtccgatccgtcacc 326

                                                                       
Query: 181 atggactcctggtccgaactccagatcaagaaaatggaagccggaggcaacaaaaaactc 240
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 327 atggactcctggtccgaactccagatcaagaaaatggaagccggagacaacaaaaaactc 386

                                                                       
Query: 241 aacaacttcctctcccaatacggcatcgccaaggaaaccgacatcgtcgccaagtacaat 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 387 aacaacttcctctcccaatacggcatcgccaaggaaaccgacatcgtcgccaagtacaat 446

                                              
Query: 301 tccaatgccgcttccatctaccgcgaccgcatcca 335
           |||||||||||||||||||||||||||||||||||
Sbjct: 447 tccaatgccgcttccatctaccgcgaccgcatcca 481


>gnl|LJGI|TC60779 similar to UniRef100_Q2HVU4 Cluster: Arf GTPase activating protein;
           n=1; Medicago truncatula|Rep: Arf GTPase activating
           protein - Medicago truncatula (Barrel medic), partial
           (50%)
          Length = 871

 Score =  276 bits (139), Expect = 4e-73
 Identities = 321/384 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcggcgtcacggcggctccgggatctccaatccgagccctccaacaagatctgcgtc 60
           ||||||||||| |||||||||||||| || |||||   |||    |||||||||||||| 
Sbjct: 60  atggcggcgtcgcggcggctccgggagctgcaatcgatgccggggaacaagatctgcgtt 119

                                                                       
Query: 61  gactgctcccnnnnnnncccccaatgggcctccgtctcctacggcgtcttcatgtgcctc 120
           ||||| ||||        || || ||||||||||||||||||||| |||||||||| |||
Sbjct: 120 gactgttcccagaagaatcctcagtgggcctccgtctcctacggcatcttcatgtgtctc 179

                                                                       
Query: 121 gaatgctccggcaaacaccgcggcctcggtgtccacatctccttcgtccgatccgtcacc 180
           || ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 180 gagtgctccggcaagcaccgcggcctcggcgtccacatctccttcgtccgatccgtcacc 239

                                                                       
Query: 181 atggactcctggtccgaactccagatcaagaaaatggaagccggaggcaacaaaaaactc 240
           |||||| ||||||||||  ||||||||||||| ||||| || || |||||| | |  |||
Sbjct: 240 atggacgcctggtccgagatccagatcaagaagatggaggcaggtggcaacgacagcctc 299

                                                                       
Query: 241 aacaacttcctctcccaatacggcatcgccaaggaaaccgacatcgtcgccaagtacaat 300
           |||  ||||||| | |  |||  |||| |||||||||||||||||||| |||||||||| 
Sbjct: 300 aacgccttcctcgctcgctactccatccccaaggaaaccgacatcgtcaccaagtacaac 359

                                                                       
Query: 301 tccaatgccgcttccatctaccgcgaccgcatccaggcgatcgccgagggccgttcctgg 360
            |||| |||||  |  |||||||||| ||||||||||| |||||||| |||||| |||||
Sbjct: 360 accaacgccgccacgctctaccgcgatcgcatccaggccatcgccgacggccgtccctgg 419

                                   
Query: 361 cgggatccaccggttgtgaaggag 384
           || ||||| || ||||| ||||||
Sbjct: 420 cgtgatccgcctgttgtcaaggag 443



 Score =  143 bits (72), Expect = 3e-33
 Identities = 194/232 (83%), Gaps = 2/232 (0%)
 Strand = Plus / Plus

                                                                       
Query: 549 gtcgaagtcgacggaggatattcacacgcggacgcagttggaggcatctgctgctaacaa 608
           ||||| |||| ||||||||||| |||||||| ||||| ||||||| || || || || ||
Sbjct: 596 gtcgaggtcgtcggaggatatttacacgcggtcgcagctggaggcttcggcggcgaataa 655

                                                                       
Query: 609 ggagagcttcttcgcgaggaagatggcggagaatgagtctaggccggatgggcttccgcc 668
           |||| |||||||||| ||||||||||||||||| |||||  | |||||||||||||||||
Sbjct: 656 ggagggcttcttcgctaggaagatggcggagaacgagtcgcgaccggatgggcttccgcc 715

                                                                       
Query: 669 gtcgcagggtggcaagtatgttggatttgggtctagtcctgcccctgc-tcaaaggagca 727
           |||||||||||| ||||| || || ||||| || || ||||| ||  | ||  | ||| |
Sbjct: 716 gtcgcagggtgggaagtacgtcgggtttggatccagccctgcgccaccgtcgca-gagga 774

                                                               
Query: 728 gcaatcctcaaaacgattatttcgatgtcgtttcgcagggaattggtaaatt 779
           ||||||| |||||||| |||||   ||||||||| ||||| |||||||||||
Sbjct: 775 gcaatccgcaaaacgactatttgtctgtcgtttcacaggggattggtaaatt 826


>gnl|LJGI|TC78740 weakly similar to UniRef100_A7PNJ6 Cluster: Chromosome chr8
            scaffold_23, whole genome shotgun sequence; n=1; Vitis
            vinifera|Rep: Chromosome chr8 scaffold_23, whole genome
            shotgun sequence - Vitis vinifera (Grape), partial (12%)
          Length = 756

 Score = 89.7 bits (45), Expect = 4e-17
 Identities = 106/125 (84%), Gaps = 6/125 (4%)
 Strand = Plus / Plus

                                                                        
Query: 1203 caactcaagttcttgggatgattgggaccacaaggatgctaggaaggtagaaccagctaa 1262
            ||||||||| ||||||||||||||||||||||| ||  || |||||| ||||||||||||
Sbjct: 205  caactcaagctcttgggatgattgggaccacaaagactctcggaaggaagaaccagctaa 264

                                                                        
Query: 1263 aggatcatctccccata---ataatgatagttgggctggctggg---atgatgccaaaga 1316
            |||||   |||| ||||   || ||||| |||||||||||||||   || ||||||||||
Sbjct: 265  aggattggctcctcataatcatgatgatggttgggctggctgggataataatgccaaaga 324

                 
Query: 1317 tgatg 1321
            |||||
Sbjct: 325  tgatg 329



 Score = 69.9 bits (35), Expect = 4e-11
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 1213 tcttgggatgattgggaccacaaggatgctaggaaggtagaaccagctaaa 1263
            ||||||||||||||||||||||| ||  ||||||||| |||||||||||||
Sbjct: 113  tcttgggatgattgggaccacaaagaccctaggaaggaagaaccagctaaa 163



 Score = 52.0 bits (26), Expect = 1e-05
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                              
Query: 1112 actcaagttcttgggatgattgggaccataaaga 1145
            ||||||| |||||||||||||||||||| |||||
Sbjct: 207  actcaagctcttgggatgattgggaccacaaaga 240


>gnl|LJGI|TC74350 similar to UniRef100_Q2HVU4 Cluster: Arf GTPase activating protein;
            n=1; Medicago truncatula|Rep: Arf GTPase activating
            protein - Medicago truncatula (Barrel medic), partial
            (6%)
          Length = 654

 Score = 89.7 bits (45), Expect = 4e-17
 Identities = 106/125 (84%), Gaps = 6/125 (4%)
 Strand = Plus / Plus

                                                                        
Query: 1203 caactcaagttcttgggatgattgggaccacaaggatgctaggaaggtagaaccagctaa 1262
            ||||||||| ||||||||||||||||||||||| ||  || |||||| ||||||||||||
Sbjct: 19   caactcaagctcttgggatgattgggaccacaaagactctcggaaggaagaaccagctaa 78

                                                                        
Query: 1263 aggatcatctccccata---ataatgatagttgggctggctggg---atgatgccaaaga 1316
            |||||   |||| ||||   || ||||| |||||||||||||||   || ||||||||||
Sbjct: 79   aggattggctcctcataatcatgatgatggttgggctggctgggataataatgccaaaga 138

                 
Query: 1317 tgatg 1321
            |||||
Sbjct: 139  tgatg 143



 Score = 52.0 bits (26), Expect = 1e-05
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                              
Query: 1112 actcaagttcttgggatgattgggaccataaaga 1145
            ||||||| |||||||||||||||||||| |||||
Sbjct: 21   actcaagctcttgggatgattgggaccacaaaga 54


>gnl|LJGI|TC63472 weakly similar to UniRef100_Q2HVU4 Cluster: Arf GTPase activating
            protein; n=1; Medicago truncatula|Rep: Arf GTPase
            activating protein - Medicago truncatula (Barrel medic),
            partial (9%)
          Length = 682

 Score = 89.7 bits (45), Expect = 4e-17
 Identities = 106/125 (84%), Gaps = 6/125 (4%)
 Strand = Plus / Plus

                                                                        
Query: 1203 caactcaagttcttgggatgattgggaccacaaggatgctaggaaggtagaaccagctaa 1262
            ||||||||| ||||||||||||||||||||||| ||  || |||||| ||||||||||||
Sbjct: 125  caactcaagctcttgggatgattgggaccacaaagactctcggaaggaagaaccagctaa 184

                                                                        
Query: 1263 aggatcatctccccata---ataatgatagttgggctggctggg---atgatgccaaaga 1316
            |||||   |||| ||||   || ||||| |||||||||||||||   || ||||||||||
Sbjct: 185  aggattggctcctcataatcatgatgatggttgggctggctgggataataatgccaaaga 244

                 
Query: 1317 tgatg 1321
            |||||
Sbjct: 245  tgatg 249



 Score = 69.9 bits (35), Expect = 4e-11
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 1213 tcttgggatgattgggaccacaaggatgctaggaaggtagaaccagctaaa 1263
            ||||||||||||||||||||||| ||  ||||||||| |||||||||||||
Sbjct: 33   tcttgggatgattgggaccacaaagaccctaggaaggaagaaccagctaaa 83



 Score = 52.0 bits (26), Expect = 1e-05
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                              
Query: 1112 actcaagttcttgggatgattgggaccataaaga 1145
            ||||||| |||||||||||||||||||| |||||
Sbjct: 127  actcaagctcttgggatgattgggaccacaaaga 160