Miyakogusa Predicted Gene
- Lj1g3v4551240.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v4551240.1 Non Chatacterized Hit- tr|I1N9Z5|I1N9Z5_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,75,0,Putative GTP-ase
activating proteins for the,Arf GTPase activating protein; ArfGap,Arf
GTPase activa,CUFF.32637.1
(1392 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC82355 similar to UniRef100_Q2HVU4 Cluster: Arf GTPase... 868 0.0
gnl|LJGI|TC75091 similar to UniRef100_Q2HVU4 Cluster: Arf GTPase... 678 0.0
gnl|LJGI|TC78145 homologue to UniRef100_Q2HVU4 Cluster: Arf GTPa... 615 e-175
gnl|LJGI|TC60779 similar to UniRef100_Q2HVU4 Cluster: Arf GTPase... 276 4e-73
gnl|LJGI|TC78740 weakly similar to UniRef100_A7PNJ6 Cluster: Chr... 90 4e-17
gnl|LJGI|TC74350 similar to UniRef100_Q2HVU4 Cluster: Arf GTPase... 90 4e-17
gnl|LJGI|TC63472 weakly similar to UniRef100_Q2HVU4 Cluster: Arf... 90 4e-17
>gnl|LJGI|TC82355 similar to UniRef100_Q2HVU4 Cluster: Arf GTPase activating protein;
n=1; Medicago truncatula|Rep: Arf GTPase activating
protein - Medicago truncatula (Barrel medic), partial
(33%)
Length = 438
Score = 868 bits (438), Expect = 0.0
Identities = 438/438 (100%)
Strand = Plus / Plus
Query: 485 ggcggaatcagtctactggagatgttttggggtttggtggtggaggcggagtggttccgt 544
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 ggcggaatcagtctactggagatgttttggggtttggtggtggaggcggagtggttccgt 60
Query: 545 cgaggtcgaagtcgacggaggatattcacacgcggacgcagttggaggcatctgctgcta 604
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 cgaggtcgaagtcgacggaggatattcacacgcggacgcagttggaggcatctgctgcta 120
Query: 605 acaaggagagcttcttcgcgaggaagatggcggagaatgagtctaggccggatgggcttc 664
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 acaaggagagcttcttcgcgaggaagatggcggagaatgagtctaggccggatgggcttc 180
Query: 665 cgccgtcgcagggtggcaagtatgttggatttgggtctagtcctgcccctgctcaaagga 724
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 cgccgtcgcagggtggcaagtatgttggatttgggtctagtcctgcccctgctcaaagga 240
Query: 725 gcagcaatcctcaaaacgattatttcgatgtcgtttcgcagggaattggtaaattatcat 784
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 gcagcaatcctcaaaacgattatttcgatgtcgtttcgcagggaattggtaaattatcat 300
Query: 785 tagttgttcaggcaggaaccaaagagttaacttccaaggtaaaggagggtggttatgatt 844
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301 tagttgttcaggcaggaaccaaagagttaacttccaaggtaaaggagggtggttatgatt 360
Query: 845 acaaagtcaatgaaactgtcaatattgtctctcagaagacatcggagattggacaaagga 904
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 361 acaaagtcaatgaaactgtcaatattgtctctcagaagacatcggagattggacaaagga 420
Query: 905 catggggtataatgaaag 922
||||||||||||||||||
Sbjct: 421 catggggtataatgaaag 438
>gnl|LJGI|TC75091 similar to UniRef100_Q2HVU4 Cluster: Arf GTPase activating protein;
n=1; Medicago truncatula|Rep: Arf GTPase activating
protein - Medicago truncatula (Barrel medic), partial
(19%)
Length = 764
Score = 678 bits (342), Expect = 0.0
Identities = 345/346 (99%)
Strand = Plus / Plus
Query: 1047 gaataaaggttggaattcttctatcagagaaggacagccttcatcaggtggacaaactaa 1106
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2 gaataaaggttggaattcttctatcagagaaggacagccttcatcaggtggacaaactaa 61
Query: 1107 tacttactcaagttcttgggatgattgggaccataaagattccacaaagggaggtccagc 1166
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 62 tacttactcaagttcttgggatgattgggaccatgaagattccacaaagggaggtccagc 121
Query: 1167 tagaggatcagctcctcagtcatccaatgggaggaacaactcaagttcttgggatgattg 1226
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 122 tagaggatcagctcctcagtcatccaatgggaggaacaactcaagttcttgggatgattg 181
Query: 1227 ggaccacaaggatgctaggaaggtagaaccagctaaaggatcatctccccataataatga 1286
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 182 ggaccacaaggatgctaggaaggtagaaccagctaaaggatcatctccccataataatga 241
Query: 1287 tagttgggctggctgggatgatgccaaagatgatgacttcgataataaagctagtgatca 1346
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 242 tagttgggctggctgggatgatgccaaagatgatgacttcgataataaagctagtgatca 301
Query: 1347 taatggaacatcaggttctggctggacaggaggaggctttctctaa 1392
||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 302 taatggaacatcaggttctggctggacaggaggaggctttctctaa 347
>gnl|LJGI|TC78145 homologue to UniRef100_Q2HVU4 Cluster: Arf GTPase activating
protein; n=1; Medicago truncatula|Rep: Arf GTPase
activating protein - Medicago truncatula (Barrel medic),
partial (25%)
Length = 481
Score = 615 bits (310), Expect = e-175
Identities = 327/335 (97%)
Strand = Plus / Plus
Query: 1 atggcggcgtcacggcggctccgggatctccaatccgagccctccaacaagatctgcgtc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 147 atggcggcgtcacggcggctccgggatctccaatccgagccctccaacaagatctgcgtc 206
Query: 61 gactgctcccnnnnnnncccccaatgggcctccgtctcctacggcgtcttcatgtgcctc 120
|||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 207 gactgctcccaaaaaaacccccaatgggcctccgtctcctacggcgtcttcatgtgcctc 266
Query: 121 gaatgctccggcaaacaccgcggcctcggtgtccacatctccttcgtccgatccgtcacc 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 267 gaatgctccggcaaacaccgcggcctcggtgtccacatctccttcgtccgatccgtcacc 326
Query: 181 atggactcctggtccgaactccagatcaagaaaatggaagccggaggcaacaaaaaactc 240
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 327 atggactcctggtccgaactccagatcaagaaaatggaagccggagacaacaaaaaactc 386
Query: 241 aacaacttcctctcccaatacggcatcgccaaggaaaccgacatcgtcgccaagtacaat 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 387 aacaacttcctctcccaatacggcatcgccaaggaaaccgacatcgtcgccaagtacaat 446
Query: 301 tccaatgccgcttccatctaccgcgaccgcatcca 335
|||||||||||||||||||||||||||||||||||
Sbjct: 447 tccaatgccgcttccatctaccgcgaccgcatcca 481
>gnl|LJGI|TC60779 similar to UniRef100_Q2HVU4 Cluster: Arf GTPase activating protein;
n=1; Medicago truncatula|Rep: Arf GTPase activating
protein - Medicago truncatula (Barrel medic), partial
(50%)
Length = 871
Score = 276 bits (139), Expect = 4e-73
Identities = 321/384 (83%)
Strand = Plus / Plus
Query: 1 atggcggcgtcacggcggctccgggatctccaatccgagccctccaacaagatctgcgtc 60
||||||||||| |||||||||||||| || ||||| ||| ||||||||||||||
Sbjct: 60 atggcggcgtcgcggcggctccgggagctgcaatcgatgccggggaacaagatctgcgtt 119
Query: 61 gactgctcccnnnnnnncccccaatgggcctccgtctcctacggcgtcttcatgtgcctc 120
||||| |||| || || ||||||||||||||||||||| |||||||||| |||
Sbjct: 120 gactgttcccagaagaatcctcagtgggcctccgtctcctacggcatcttcatgtgtctc 179
Query: 121 gaatgctccggcaaacaccgcggcctcggtgtccacatctccttcgtccgatccgtcacc 180
|| ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 180 gagtgctccggcaagcaccgcggcctcggcgtccacatctccttcgtccgatccgtcacc 239
Query: 181 atggactcctggtccgaactccagatcaagaaaatggaagccggaggcaacaaaaaactc 240
|||||| |||||||||| ||||||||||||| ||||| || || |||||| | | |||
Sbjct: 240 atggacgcctggtccgagatccagatcaagaagatggaggcaggtggcaacgacagcctc 299
Query: 241 aacaacttcctctcccaatacggcatcgccaaggaaaccgacatcgtcgccaagtacaat 300
||| ||||||| | | ||| |||| |||||||||||||||||||| ||||||||||
Sbjct: 300 aacgccttcctcgctcgctactccatccccaaggaaaccgacatcgtcaccaagtacaac 359
Query: 301 tccaatgccgcttccatctaccgcgaccgcatccaggcgatcgccgagggccgttcctgg 360
|||| ||||| | |||||||||| ||||||||||| |||||||| |||||| |||||
Sbjct: 360 accaacgccgccacgctctaccgcgatcgcatccaggccatcgccgacggccgtccctgg 419
Query: 361 cgggatccaccggttgtgaaggag 384
|| ||||| || ||||| ||||||
Sbjct: 420 cgtgatccgcctgttgtcaaggag 443
Score = 143 bits (72), Expect = 3e-33
Identities = 194/232 (83%), Gaps = 2/232 (0%)
Strand = Plus / Plus
Query: 549 gtcgaagtcgacggaggatattcacacgcggacgcagttggaggcatctgctgctaacaa 608
||||| |||| ||||||||||| |||||||| ||||| ||||||| || || || || ||
Sbjct: 596 gtcgaggtcgtcggaggatatttacacgcggtcgcagctggaggcttcggcggcgaataa 655
Query: 609 ggagagcttcttcgcgaggaagatggcggagaatgagtctaggccggatgggcttccgcc 668
|||| |||||||||| ||||||||||||||||| ||||| | |||||||||||||||||
Sbjct: 656 ggagggcttcttcgctaggaagatggcggagaacgagtcgcgaccggatgggcttccgcc 715
Query: 669 gtcgcagggtggcaagtatgttggatttgggtctagtcctgcccctgc-tcaaaggagca 727
|||||||||||| ||||| || || ||||| || || ||||| || | || | ||| |
Sbjct: 716 gtcgcagggtgggaagtacgtcgggtttggatccagccctgcgccaccgtcgca-gagga 774
Query: 728 gcaatcctcaaaacgattatttcgatgtcgtttcgcagggaattggtaaatt 779
||||||| |||||||| ||||| ||||||||| ||||| |||||||||||
Sbjct: 775 gcaatccgcaaaacgactatttgtctgtcgtttcacaggggattggtaaatt 826
>gnl|LJGI|TC78740 weakly similar to UniRef100_A7PNJ6 Cluster: Chromosome chr8
scaffold_23, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr8 scaffold_23, whole genome
shotgun sequence - Vitis vinifera (Grape), partial (12%)
Length = 756
Score = 89.7 bits (45), Expect = 4e-17
Identities = 106/125 (84%), Gaps = 6/125 (4%)
Strand = Plus / Plus
Query: 1203 caactcaagttcttgggatgattgggaccacaaggatgctaggaaggtagaaccagctaa 1262
||||||||| ||||||||||||||||||||||| || || |||||| ||||||||||||
Sbjct: 205 caactcaagctcttgggatgattgggaccacaaagactctcggaaggaagaaccagctaa 264
Query: 1263 aggatcatctccccata---ataatgatagttgggctggctggg---atgatgccaaaga 1316
||||| |||| |||| || ||||| ||||||||||||||| || ||||||||||
Sbjct: 265 aggattggctcctcataatcatgatgatggttgggctggctgggataataatgccaaaga 324
Query: 1317 tgatg 1321
|||||
Sbjct: 325 tgatg 329
Score = 69.9 bits (35), Expect = 4e-11
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1213 tcttgggatgattgggaccacaaggatgctaggaaggtagaaccagctaaa 1263
||||||||||||||||||||||| || ||||||||| |||||||||||||
Sbjct: 113 tcttgggatgattgggaccacaaagaccctaggaaggaagaaccagctaaa 163
Score = 52.0 bits (26), Expect = 1e-05
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 1112 actcaagttcttgggatgattgggaccataaaga 1145
||||||| |||||||||||||||||||| |||||
Sbjct: 207 actcaagctcttgggatgattgggaccacaaaga 240
>gnl|LJGI|TC74350 similar to UniRef100_Q2HVU4 Cluster: Arf GTPase activating protein;
n=1; Medicago truncatula|Rep: Arf GTPase activating
protein - Medicago truncatula (Barrel medic), partial
(6%)
Length = 654
Score = 89.7 bits (45), Expect = 4e-17
Identities = 106/125 (84%), Gaps = 6/125 (4%)
Strand = Plus / Plus
Query: 1203 caactcaagttcttgggatgattgggaccacaaggatgctaggaaggtagaaccagctaa 1262
||||||||| ||||||||||||||||||||||| || || |||||| ||||||||||||
Sbjct: 19 caactcaagctcttgggatgattgggaccacaaagactctcggaaggaagaaccagctaa 78
Query: 1263 aggatcatctccccata---ataatgatagttgggctggctggg---atgatgccaaaga 1316
||||| |||| |||| || ||||| ||||||||||||||| || ||||||||||
Sbjct: 79 aggattggctcctcataatcatgatgatggttgggctggctgggataataatgccaaaga 138
Query: 1317 tgatg 1321
|||||
Sbjct: 139 tgatg 143
Score = 52.0 bits (26), Expect = 1e-05
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 1112 actcaagttcttgggatgattgggaccataaaga 1145
||||||| |||||||||||||||||||| |||||
Sbjct: 21 actcaagctcttgggatgattgggaccacaaaga 54
>gnl|LJGI|TC63472 weakly similar to UniRef100_Q2HVU4 Cluster: Arf GTPase activating
protein; n=1; Medicago truncatula|Rep: Arf GTPase
activating protein - Medicago truncatula (Barrel medic),
partial (9%)
Length = 682
Score = 89.7 bits (45), Expect = 4e-17
Identities = 106/125 (84%), Gaps = 6/125 (4%)
Strand = Plus / Plus
Query: 1203 caactcaagttcttgggatgattgggaccacaaggatgctaggaaggtagaaccagctaa 1262
||||||||| ||||||||||||||||||||||| || || |||||| ||||||||||||
Sbjct: 125 caactcaagctcttgggatgattgggaccacaaagactctcggaaggaagaaccagctaa 184
Query: 1263 aggatcatctccccata---ataatgatagttgggctggctggg---atgatgccaaaga 1316
||||| |||| |||| || ||||| ||||||||||||||| || ||||||||||
Sbjct: 185 aggattggctcctcataatcatgatgatggttgggctggctgggataataatgccaaaga 244
Query: 1317 tgatg 1321
|||||
Sbjct: 245 tgatg 249
Score = 69.9 bits (35), Expect = 4e-11
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1213 tcttgggatgattgggaccacaaggatgctaggaaggtagaaccagctaaa 1263
||||||||||||||||||||||| || ||||||||| |||||||||||||
Sbjct: 33 tcttgggatgattgggaccacaaagaccctaggaaggaagaaccagctaaa 83
Score = 52.0 bits (26), Expect = 1e-05
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 1112 actcaagttcttgggatgattgggaccataaaga 1145
||||||| |||||||||||||||||||| |||||
Sbjct: 127 actcaagctcttgggatgattgggaccacaaaga 160