Miyakogusa Predicted Gene

Lj1g3v4528480.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v4528480.1 CUFF.32568.1
         (300 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC82592 homologue to UniRef100_Q70I29 Cluster: S-recept...    50   8e-06
gnl|LJGI|TC80981 similar to UniRef100_Q9VTF1 Cluster: CG32071-PA...    50   8e-06

>gnl|LJGI|TC82592 homologue to UniRef100_Q70I29 Cluster: S-receptor kinase-like
           protein 2; n=1; Lotus japonicus|Rep: S-receptor
           kinase-like protein 2 - Lotus japonicus, partial (6%)
          Length = 862

 Score = 50.1 bits (25), Expect = 8e-06
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 240 gagggttggtttatgggtggtggct 264
           |||||||||||||||||||||||||
Sbjct: 167 gagggttggtttatgggtggtggct 143


>gnl|LJGI|TC80981 similar to UniRef100_Q9VTF1 Cluster: CG32071-PA; n=1; Drosophila
           melanogaster|Rep: CG32071-PA - Drosophila melanogaster
           (Fruit fly), partial (11%)
          Length = 494

 Score = 50.1 bits (25), Expect = 8e-06
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 240 gagggttggtttatgggtggtggct 264
           |||||||||||||||||||||||||
Sbjct: 250 gagggttggtttatgggtggtggct 226