Miyakogusa Predicted Gene

Lj1g3v4263380.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v4263380.1 Non Chatacterized Hit- tr|I1MLB7|I1MLB7_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.23489
PE,53.33,0.00004,no description,NULL,CUFF.32145.1
         (225 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC63139 similar to UniRef100_Q2HUJ7 Cluster: V-ATPase s...   141   2e-33

>gnl|LJGI|TC63139 similar to UniRef100_Q2HUJ7 Cluster: V-ATPase subunit C; n=1;
           Medicago truncatula|Rep: V-ATPase subunit C - Medicago
           truncatula (Barrel medic), partial (97%)
          Length = 1500

 Score =  141 bits (71), Expect = 2e-33
 Identities = 77/79 (97%)
 Strand = Plus / Plus

                                                                       
Query: 121 tatgctctttatactgtgacgctcttcagtcatgttgcggacaattttagaaacaatgct 180
           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 688 tatgctctttatactgtgacgctcttcagtcgtgttgcggacaattttagaaacagtgct 747

                              
Query: 181 cgggaaaaagggatccaag 199
           |||||||||||||||||||
Sbjct: 748 cgggaaaaagggatccaag 766