Miyakogusa Predicted Gene

Lj1g3v4226690.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v4226690.1 tr|G2XMG9|G2XMG9_ORYBR Hypothetical_protein
OS=Oryza brachyantha GN=Ob12g0074O16_11 PE=4
SV=1,50.56,1e-18,seg,NULL,CUFF.32075.1
         (1026 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC80075                                                       72   8e-12

>gnl|LJGI|TC80075 
          Length = 1098

 Score = 71.9 bits (36), Expect = 8e-12
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 313 cctgatcccgacatttacattgacgatgtagattggaattcaagtgttgaccctga 368
           ||||||||  ||||||||||||| ||| ||||||||||||||| ||||||||||||
Sbjct: 383 cctgatcctaacatttacattgatgatatagattggaattcaattgttgaccctga 438