Miyakogusa Predicted Gene
- Lj1g3v4139340.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v4139340.1 tr|Q6I608|Q6I608_ORYSJ Os05g0556900 protein
OS=Oryza sativa subsp. japonica GN=OJ1214_E03.11 PE=1
SV,76.27,2e-19,Ribosomal_L35Ae,Ribosomal protein L35A; 60S RIBOSOMAL
PROTEIN L35A,NULL; 60S RIBOSOMAL PROTEIN
L35A,,NODE_44211_length_208_cov_760.216370.path1.1
(183 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC66874 homologue to UniRef100_Q9ATF4 Cluster: Ribosoma... 359 4e-99
gnl|LJGI|TC66898 homologue to UniRef100_Q9ATF4 Cluster: Ribosoma... 98 2e-20
gnl|LJGI|BW594752 homologue to UniRef100_Q9ATF4 Cluster: Ribosom... 84 3e-16
>gnl|LJGI|TC66874 homologue to UniRef100_Q9ATF4 Cluster: Ribosomal protein L33; n=1;
Castanea sativa|Rep: Ribosomal protein L33 - Castanea
sativa (Sweet chestnut), complete
Length = 602
Score = 359 bits (181), Expect = 4e-99
Identities = 181/181 (100%)
Strand = Plus / Plus
Query: 1 atggcgtacatttacaaagccaaggtaaagcagaatggaactcactatcgctgcatttgg 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 234 atggcgtacatttacaaagccaaggtaaagcagaatggaactcactatcgctgcatttgg 293
Query: 61 gggaaggttatcaggcctcatggtaacagcggtgtagtccgcgctaagttcaagtcaaac 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 294 gggaaggttatcaggcctcatggtaacagcggtgtagtccgcgctaagttcaagtcaaac 353
Query: 121 ctgccaccacgatccatgggtgcgagagttagagtcttcatgtacccaagcaatatatga 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 354 ctgccaccacgatccatgggtgcgagagttagagtcttcatgtacccaagcaatatatga 413
Query: 181 g 181
|
Sbjct: 414 g 414
>gnl|LJGI|TC66898 homologue to UniRef100_Q9ATF4 Cluster: Ribosomal protein L33; n=1;
Castanea sativa|Rep: Ribosomal protein L33 - Castanea
sativa (Sweet chestnut), complete
Length = 644
Score = 97.6 bits (49), Expect = 2e-20
Identities = 139/169 (82%)
Strand = Plus / Plus
Query: 13 tacaaagccaaggtaaagcagaatggaactcactatcgctgcatttgggggaaggttatc 72
||||| |||||||| ||| |||||||||| ||||| |||||||| ||||| |||||||
Sbjct: 224 tacaaggccaaggtgaagaagaatggaacccactaccgctgcatatggggcaaggttaca 283
Query: 73 aggcctcatggtaacagcggtgtagtccgcgctaagttcaagtcaaacctgccaccacga 132
||||| || |||||||| ||||| || ||| | || |||||||||||||| || || ||
Sbjct: 284 aggccccacggtaacagtggtgttgttcgcacaaaattcaagtcaaaccttcctcctaga 343
Query: 133 tccatgggtgcgagagttagagtcttcatgtacccaagcaatatatgag 181
|| ||||| || | || ||||| |||||||| |||||||| |||||||
Sbjct: 344 tcaatgggagcacgggtaagagttttcatgtatccaagcaacatatgag 392
>gnl|LJGI|BW594752 homologue to UniRef100_Q9ATF4 Cluster: Ribosomal protein L33; n=1;
Castanea sativa|Rep: Ribosomal protein L33 - Castanea
sativa (Sweet chestnut), complete
Length = 482
Score = 83.8 bits (42), Expect = 3e-16
Identities = 93/110 (84%)
Strand = Plus / Plus
Query: 13 tacaaagccaaggtaaagcagaatggaactcactatcgctgcatttgggggaaggttatc 72
||||| |||||||| ||| |||||||||| ||||| |||||||| ||||| |||||||
Sbjct: 217 tacaaggccaaggtgaagaagaatggaacccactaccgctgcatatggggcaaggttaca 276
Query: 73 aggcctcatggtaacagcggtgtagtccgcgctaagttcaagtcaaacct 122
||||| || |||||||| ||||| || ||| | || ||||||||||||||
Sbjct: 277 aggccccacggtaacagtggtgttgttcgcacaaaattcaagtcaaacct 326