Miyakogusa Predicted Gene

Lj1g3v4118230.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v4118230.1 tr|Q2HSX6|Q2HSX6_MEDTR Cyclin-like F-box
OS=Medicago truncatula GN=MTR_7g089730 PE=4
SV=1,73.21,9e-16,FBOX,F-box domain, cyclin-like; F-box,F-box domain,
cyclin-like; F-box domain,F-box domain, cyclin-l,CUFF.31986.1
         (423 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO024643 weakly similar to UniRef100_Q2HSX6 Cluster: Cy...   208   2e-53

>gnl|LJGI|GO024643 weakly similar to UniRef100_Q2HSX6 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (49%)
          Length = 631

 Score =  208 bits (105), Expect = 2e-53
 Identities = 144/157 (91%)
 Strand = Plus / Plus

                                                                       
Query: 36  tctcttgaatcttcctgaactcattcttgattgcatcctcaaacgcctctcaccaatgga 95
           |||||||||| | ||||||| |||||| |||||||||||||||| |||||||||||| ||
Sbjct: 53  tctcttgaatttgcctgaacccattctggattgcatcctcaaactcctctcaccaatcga 112

                                                                       
Query: 96  gctcatcaaaatgtccgaggtgtgcacttgtttaagggatgcatgtagaagcgatcatct 155
           ||||||||||||||||  |||||||||||||||||||||||||||| |||| |||||| |
Sbjct: 113 gctcatcaaaatgtccatggtgtgcacttgtttaagggatgcatgtcgaagtgatcattt 172

                                                
Query: 156 gtgggaaaacctcatcaaccagaaatggggtagaatc 192
           ||||||||||| |||||||||||||||||||| ||||
Sbjct: 173 gtgggaaaaccacatcaaccagaaatggggtacaatc 209