Miyakogusa Predicted Gene

Lj1g3v4047380.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v4047380.1 Non Chatacterized Hit- tr|I1M4I8|I1M4I8_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.19750
PE,40.82,2e-17,seg,NULL; coiled-coil,NULL,CUFF.31894.1
         (3696 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW595210 similar to UniRef100_Q4R5B8 Cluster: Eukaryoti...    54   6e-06

>gnl|LJGI|BW595210 similar to UniRef100_Q4R5B8 Cluster: Eukaryotic translation
            initiation factor 3 subunit F; n=1; Macaca
            fascicularis|Rep: Eukaryotic translation initiation
            factor 3 subunit F - Macaca fascicularis (Crab eating
            macaque) (Cynomolgus monkey), partial (7%)
          Length = 488

 Score = 54.0 bits (27), Expect = 6e-06
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 3057 tcaagctggtgggcagatacgggcccctgcaccacatctccagcctt 3103
            ||||| ||||||  ||||||| ||||||||||||||||| |||||||
Sbjct: 262  tcaaggtggtggtgagatacgtgcccctgcaccacatctgcagcctt 308