Miyakogusa Predicted Gene
- Lj1g3v4047380.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v4047380.1 Non Chatacterized Hit- tr|I1M4I8|I1M4I8_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.19750
PE,40.82,2e-17,seg,NULL; coiled-coil,NULL,CUFF.31894.1
(3696 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BW595210 similar to UniRef100_Q4R5B8 Cluster: Eukaryoti... 54 6e-06
>gnl|LJGI|BW595210 similar to UniRef100_Q4R5B8 Cluster: Eukaryotic translation
initiation factor 3 subunit F; n=1; Macaca
fascicularis|Rep: Eukaryotic translation initiation
factor 3 subunit F - Macaca fascicularis (Crab eating
macaque) (Cynomolgus monkey), partial (7%)
Length = 488
Score = 54.0 bits (27), Expect = 6e-06
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 3057 tcaagctggtgggcagatacgggcccctgcaccacatctccagcctt 3103
||||| |||||| ||||||| ||||||||||||||||| |||||||
Sbjct: 262 tcaaggtggtggtgagatacgtgcccctgcaccacatctgcagcctt 308