Miyakogusa Predicted Gene

Lj1g3v4012900.2

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v4012900.2 tr|G7L2L5|G7L2L5_MEDTR Cysteine synthase
OS=Medicago truncatula GN=MTR_7g087110 PE=3
SV=1,82.22,0,CYS_SYNTHASE,Cysteine synthase/cystathionine
beta-synthase P-phosphate-binding site; cysK: cysteine ,CUFF.31774.2
         (1116 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP052652 similar to UniRef100_Q43725 Cluster: Cysteine ...   303   1e-81
gnl|LJGI|TC61783 homologue to UniRef100_A5YT88 Cluster: Cysteine...    62   8e-09
gnl|LJGI|TC62606 homologue to UniRef100_Q8W1A0 Cluster: Cysteine...    52   8e-06

>gnl|LJGI|BP052652 similar to UniRef100_Q43725 Cluster: Cysteine synthase, mitochondrial
            precursor  (O- acetylserine sulfhydrylase)
            (O-acetylserine (Thiol)-lyase); n=3; Arabidopsis
            thaliana|Rep: Cysteine synthase, mitochondrial precursor 
            (O- acetylserine sulfhydrylase) (O-acetylserine
            (Thiol)-lyase) - Arabidopsis thaliana (Mouse-ear cress),
            partial (11%)
          Length = 518

 Score =  303 bits (153), Expect = 1e-81
 Identities = 153/153 (100%)
 Strand = Plus / Minus

                                                                        
Query: 964  tcaggagctgcagcagctgctgccctaagtttagcaagacggcctgagaattctggaaaa 1023
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 516  tcaggagctgcagcagctgctgccctaagtttagcaagacggcctgagaattctggaaaa 457

                                                                        
Query: 1024 cttattgtggttatttttcctagttttggtgagaggtatatttccactcccctcttcaat 1083
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 456  cttattgtggttatttttcctagttttggtgagaggtatatttccactcccctcttcaat 397

                                             
Query: 1084 tctatctatgaagaggttcagaaaatgtaacaa 1116
            |||||||||||||||||||||||||||||||||
Sbjct: 396  tctatctatgaagaggttcagaaaatgtaacaa 364


>gnl|LJGI|TC61783 homologue to UniRef100_A5YT88 Cluster: Cysteine synthase; n=1;
           Glycine max|Rep: Cysteine synthase - Glycine max
           (Soybean), partial (98%)
          Length = 1667

 Score = 61.9 bits (31), Expect = 8e-09
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 274 gctaatattgctgcaaaacttgagtccatggagccttgtagaagtgtcaaggacagaatt 333
           |||||||||||||| || ||||||   |||||||| ||| | |||||||||||||| || 
Sbjct: 453 gctaatattgctgctaagcttgagattatggagccatgttgcagtgtcaaggacaggata 512

                                  
Query: 334 gggtatagcatgttagctgatgc 356
           || ||||||||| || |||||||
Sbjct: 513 ggttatagcatgataactgatgc 535


>gnl|LJGI|TC62606 homologue to UniRef100_Q8W1A0 Cluster: Cysteine synthase; n=1;
            Glycine max|Rep: Cysteine synthase - Glycine max
            (Soybean), complete
          Length = 1456

 Score = 52.0 bits (26), Expect = 8e-06
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1016 ctggaaaacttattgtggttatttttcctagttttggtgagaggta 1061
            ||||||||||||| || ||| ||||||| || ||||||||||||||
Sbjct: 959  ctggaaaacttatcgttgttgtttttccaagctttggtgagaggta 1004