Miyakogusa Predicted Gene

Lj1g3v3992560.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3992560.1 tr|A2Q4D1|A2Q4D1_MEDTR Homeodomain-related
OS=Medicago truncatula GN=MTR_7g086960 PE=4 SV=1,56.74,0,HTH_MYB,Myb
domain; SANT  SWI3, ADA2, N-CoR and TFIIIB'' DNA-bin,SANT/Myb domain;
Myb_DNA-binding,SA,CUFF.31746.1
         (1146 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC79329 similar to UniRef100_Q97DJ9 Cluster: Predicted ...   256   3e-67
gnl|LJGI|TC63421 similar to UniRef100_A7NSM1 Cluster: Chromosome...   105   6e-22
gnl|LJGI|AV766688 similar to UniRef100_Q0PJC1 Cluster: MYB trans...    54   2e-06

>gnl|LJGI|TC79329 similar to UniRef100_Q97DJ9 Cluster: Predicted membrane protein;
           n=1; Clostridium acetobutylicum|Rep: Predicted membrane
           protein - Clostridium acetobutylicum, partial (8%)
          Length = 589

 Score =  256 bits (129), Expect = 3e-67
 Identities = 129/129 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaatcctcagcacttgatcaatggttgtgaaggtttcagtagtggggatcataagagt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 461 atgaatcctcagcacttgatcaatggttgtgaaggtttcagtagtggggatcataagagt 520

                                                                       
Query: 61  ttcttgatcccttcactacctgttccttcttctcttcttgttggttcccaatctcctgtt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 521 ttcttgatcccttcactacctgttccttcttctcttcttgttggttcccaatctcctgtt 580

                    
Query: 121 ccttttcag 129
           |||||||||
Sbjct: 581 ccttttcag 589


>gnl|LJGI|TC63421 similar to UniRef100_A7NSM1 Cluster: Chromosome chr18 scaffold_1,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr18 scaffold_1, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (48%)
          Length = 1244

 Score =  105 bits (53), Expect = 6e-22
 Identities = 179/221 (80%)
 Strand = Plus / Plus

                                                                       
Query: 400 ctcccaggaagatcaggcaaaagttgcagattgaggtggttcaatcagctagacccaaga 459
           |||| |||||||||||| |||||||||||||||||||||||||| ||||| || ||||||
Sbjct: 200 ctccaaggaagatcaggaaaaagttgcagattgaggtggttcaaccagcttgatccaaga 259

                                                                       
Query: 460 atcaacaagagggcattttctgaggaggaagaggagaggctcttaggtgctcacacaatg 519
           || ||||  ||| ||||  | || |||||||| ||||||||  | |  ||||||| | | 
Sbjct: 260 attaacagaaggccattcacagaagaggaagaagagaggctacttgcagctcacagagtt 319

                                                                       
Query: 520 tatggtaacaaatgggctttgattgctaggctttttcctggaaggacagataatgcagtg 579
            |||| ||||| |||||  | || || ||||| || || || || || |||||||| |||
Sbjct: 320 catgggaacaagtgggccctcatagcaaggctcttcccaggtagaactgataatgctgtg 379

                                                    
Query: 580 aagaaccattggcatgtcatcatggctaggaggcacaggga 620
           ||||| || ||||||||||||||||| |||| ||| |||||
Sbjct: 380 aagaatcactggcatgtcatcatggcaaggaagcagaggga 420


>gnl|LJGI|AV766688 similar to UniRef100_Q0PJC1 Cluster: MYB transcription factor
           MYB122; n=1; Glycine max|Rep: MYB transcription factor
           MYB122 - Glycine max (Soybean), partial (77%)
          Length = 595

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 559 ggaaggacagataatgcagtgaagaaccattggca 593
           ||||| |||||||||| ||||||||||||||||||
Sbjct: 368 ggaagaacagataatgaagtgaagaaccattggca 402