Miyakogusa Predicted Gene

Lj1g3v3978180.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3978180.1 Non Chatacterized Hit- tr|K4BKP5|K4BKP5_SOLLC
Uncharacterized protein OS=Solanum lycopersicum
GN=Sol,64.86,0,HSP20,Alpha crystallin/Hsp20 domain; HEAT-SHOCK PROTEIN
17,NULL; SMALL HEAT-SHOCK PROTEIN (HSP20) FA,CUFF.31711.1
         (591 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW596392 similar to UniRef100_P30236 Cluster: 22.0 kDa ...    58   6e-08

>gnl|LJGI|BW596392 similar to UniRef100_P30236 Cluster: 22.0 kDa class IV heat shock
           protein precursor; n=1; Glycine max|Rep: 22.0 kDa class
           IV heat shock protein precursor - Glycine max (Soybean),
           partial (26%)
          Length = 485

 Score = 58.0 bits (29), Expect = 6e-08
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                       
Query: 389 atggaaagttctggaggcagttcaggttgccggggaatgtggacttggatggtgttaagg 448
           |||| ||||||||||||||||||||||||||    ||||| |||||||||  ||||||||
Sbjct: 366 atggcaagttctggaggcagttcaggttgccaaacaatgttgacttggattctgttaagg 425

            
Query: 449 c 449
           |
Sbjct: 426 c 426