Miyakogusa Predicted Gene

Lj1g3v3963440.1
Show Alignment:  
BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3963440.1 Non Chatacterized Hit- tr|G8DCX0|G8DCX0_PHAVU
Putative retrotransposon OS=Phaseolus vulgaris PE=4
SV,50,6e-17,RRM,RNA recognition motif domain; no
description,Nucleotide-binding, alpha-beta plait; RNA
recogniti,CUFF.31588.1
         (2071 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW604002 similar to UniRef100_Q8H2B9 Cluster: 60s acidi...    76   1e-12
gnl|LJGI|TC71812 homologue to UniRef100_Q9FFC0 Cluster: Histone ...    76   1e-12

>gnl|LJGI|BW604002 similar to UniRef100_Q8H2B9 Cluster: 60s acidic ribosomal protein;
           n=1; Prunus dulcis|Rep: 60s acidic ribosomal protein -
           Prunus dulcis (Almond) (Prunus amygdalus), partial (87%)
          Length = 483

 Score = 75.8 bits (38), Expect = 1e-12
 Identities = 38/38 (100%)
 Strand = Plus / Plus

                                                 
Query: 1   atgggtgacctcctgggaagtcctcgtgttgcatcccc 38
           ||||||||||||||||||||||||||||||||||||||
Sbjct: 90  atgggtgacctcctgggaagtcctcgtgttgcatcccc 127


>gnl|LJGI|TC71812 homologue to UniRef100_Q9FFC0 Cluster: Histone H2B.10; n=2;
          Arabidopsis thaliana|Rep: Histone H2B.10 - Arabidopsis
          thaliana (Mouse-ear cress), partial (97%)
          Length = 707

 Score = 75.8 bits (38), Expect = 1e-12
 Identities = 38/38 (100%)
 Strand = Plus / Plus

                                                
Query: 1  atgggtgacctcctgggaagtcctcgtgttgcatcccc 38
          ||||||||||||||||||||||||||||||||||||||
Sbjct: 40 atgggtgacctcctgggaagtcctcgtgttgcatcccc 77