Miyakogusa Predicted Gene

Lj1g3v3945980.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3945980.1 Non Chatacterized Hit- tr|A9NWW1|A9NWW1_PICSI
Putative uncharacterized protein OS=Picea sitchensis
P,45.22,4e-19,seg,NULL; PPR: pentatricopeptide repeat
domain,Pentatricopeptide repeat; PPR,Pentatricopeptide repea,66053_g.1
         (372 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC65231                                                       52   2e-06

>gnl|LJGI|TC65231 
          Length = 673

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 1   atgcacgaaccgggttctcgaccatc 26
           ||||||||||||||||||||||||||
Sbjct: 648 atgcacgaaccgggttctcgaccatc 673