Miyakogusa Predicted Gene
- Lj1g3v3943560.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v3943560.1 tr|B6T9E1|B6T9E1_MAIZE Xyloglucan
endotransglucosylase/hydrolase OS=Zea mays PE=2 SV=1,70.49,2e-19,no
description,Concanavalin A-like lectin/glucanase, subgroup; FAMILY NOT
NAMED,NULL; seg,NULL; Conc,CUFF.31559.1
(291 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC81330 similar to UniRef100_Q2HRU5 Cluster: Glycoside ... 535 e-152
gnl|LJGI|TC58683 homologue to UniRef100_Q2HRU6 Cluster: Glycosid... 321 1e-87
>gnl|LJGI|TC81330 similar to UniRef100_Q2HRU5 Cluster: Glycoside hydrolase, family
16; Xyloglucan endo-transglycosylase, C- terminal; n=1;
Medicago truncatula|Rep: Glycoside hydrolase, family 16;
Xyloglucan endo-transglycosylase, C- terminal - Medicago
truncatula (Barrel medic), complete
Length = 936
Score = 535 bits (270), Expect = e-152
Identities = 279/282 (98%)
Strand = Plus / Plus
Query: 7 tcttctttatggaccctgtgtctgattctggcatcactagcctccgctgcaatctctgcc 66
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 tcttctttatggaccctgtgtctgattctggcatcactagcctccgctgcaatctctgcc 60
Query: 67 accccccggaggccagtggctgttccgttcggccgaaactacgtccccacatgggctttt 126
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 accccccggaggccagtggctgttccgttcggccgaaactacgtccccacatgggctttt 120
Query: 127 gatcacatcaaatacttcaatggaggttctgatattcaacttcttcttgacaagtacact 186
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 gatcacatcaaatacttcaatggaggttctgatattcaacttcttcttgacaagtacact 180
Query: 187 ggcactggcttccaatccaaaggttcatacttgtttggtcacttcagcatggacataaag 246
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 181 ggcactggcttccaatccaaaggttcatacttgtttggtcacttcagcatggacattaag 240
Query: 247 atggttcctggagattcagctggcacagtcactgctttctat 288
|||||||||| ||||||||||||||||||||||||||||||
Sbjct: 241 atggttcctgatgattcagctggcacagtcactgctttctat 282
>gnl|LJGI|TC58683 homologue to UniRef100_Q2HRU6 Cluster: Glycoside hydrolase, family
16; Xyloglucan endo-transglycosylase, C- terminal; n=1;
Medicago truncatula|Rep: Glycoside hydrolase, family 16;
Xyloglucan endo-transglycosylase, C- terminal - Medicago
truncatula (Barrel medic), complete
Length = 1166
Score = 321 bits (162), Expect = 1e-87
Identities = 198/210 (94%)
Strand = Plus / Plus
Query: 79 ccagtggctgttccgttcggccgaaactacgtccccacatgggcttttgatcacatcaaa 138
|||||| | ||||| || ||||| |||||| |||||| |||||||||||||||||||||
Sbjct: 97 ccagtgccggttccatttggccgtaactactaccccacttgggcttttgatcacatcaaa 156
Query: 139 tacttcaatggaggttctgatattcaacttcttcttgacaagtacactggcactggcttc 198
|||||||||||||||||||| ||||| || | ||||||||||||||||||||||||||||
Sbjct: 157 tacttcaatggaggttctgagattcagctccatcttgacaagtacactggcactggcttc 216
Query: 199 caatccaaaggttcatacttgtttggtcacttcagcatggacataaagatggttcctgga 258
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 217 caatccaaaggttcatacttgtttggtcacttcagcatggacataaagatggttcctgga 276
Query: 259 gattcagctggcacagtcactgctttctat 288
||||||||||||||||||||||||||||||
Sbjct: 277 gattcagctggcacagtcactgctttctat 306