Miyakogusa Predicted Gene

Lj1g3v3835540.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3835540.1 Non Chatacterized Hit- tr|I1N7S8|I1N7S8_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=4,73.8,0,Polysacc_synt_4,Putative polysaccharide biosynthesis
protein; A_thal_3515: uncharacterized plant-spe,gene.g35414.t1.1
         (717 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP029976                                                     105   4e-22
gnl|LJGI|TC72979 similar to UniRef100_A7P9V1 Cluster: Chromosome...    70   2e-11

>gnl|LJGI|BP029976 
          Length = 297

 Score =  105 bits (53), Expect = 4e-22
 Identities = 53/53 (100%)
 Strand = Plus / Minus

                                                                
Query: 665 ttgctatcccacccgctgagaattatagcgatgccacacatggattttgctaa 717
           |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 297 ttgctatcccacccgctgagaattatagcgatgccacacatggattttgctaa 245


>gnl|LJGI|TC72979 similar to UniRef100_A7P9V1 Cluster: Chromosome chr14 scaffold_9,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr14 scaffold_9, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (37%)
          Length = 559

 Score = 69.9 bits (35), Expect = 2e-11
 Identities = 77/91 (84%)
 Strand = Plus / Plus

                                                                       
Query: 158 gcaacttcctcgtctttggactaggccacgactcgctcatgtgggactcgttcaacccac 217
           |||||||||| |||||||| || ||||| ||||| |||||||||| |||  | |||||| 
Sbjct: 344 gcaacttcctagtctttgggctgggccatgactccctcatgtgggcctcaatgaacccag 403

                                          
Query: 218 gcggcaccacgctcttcctcgaggaggatcc 248
           | |||| |||||| ||||| |||||||||||
Sbjct: 404 gtggcaacacgctgttcctggaggaggatcc 434