Miyakogusa Predicted Gene

Lj1g3v3767250.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3767250.1 Non Chatacterized Hit- tr|I1LXC5|I1LXC5_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.4019
PE=,74.93,0,Pkinase,Protein kinase, catalytic domain; Serine/Threonine
protein kinases, catalytic,Serine/threoni,CUFF.31172.1
         (1193 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO010898 similar to UniRef100_Q2HV99 Cluster: Protein k...    58   1e-07
gnl|LJGI|TC81715 similar to UniRef100_Q2HV72 Cluster: Protein ki...    54   2e-06

>gnl|LJGI|GO010898 similar to UniRef100_Q2HV99 Cluster: Protein kinase; Type I EGF;
           n=1; Medicago truncatula|Rep: Protein kinase; Type I EGF
           - Medicago truncatula (Barrel medic), partial (29%)
          Length = 665

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 89/109 (81%)
 Strand = Plus / Plus

                                                                       
Query: 250 gagcaattcattaatgaggtggttgttctgtcccaaatcattcataggaatgtggtcaaa 309
           ||||| ||||| ||||||||  | || || ||||||||||  |||||||||||||| || 
Sbjct: 195 gagcagttcatcaatgaggtcatcgtgctttcccaaatcaaccataggaatgtggtgaag 254

                                                            
Query: 310 ctcttgggatgctgtttggagactgaagtacctttactagtttatgagt 358
            ||||||| || ||||| ||||| ||||| || || || ||||||||||
Sbjct: 255 atcttggggtgttgtttagagacagaagttccattgcttgtttatgagt 303


>gnl|LJGI|TC81715 similar to UniRef100_Q2HV72 Cluster: Protein kinase; n=1; Medicago
           truncatula|Rep: Protein kinase - Medicago truncatula
           (Barrel medic), partial (47%)
          Length = 1193

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 676 aaaagtgatgtatatagctttggggtagtgcttgtagagctgctaactggg 726
           ||||||||||| ||||| |||||||| || |||||||||||  ||||||||
Sbjct: 668 aaaagtgatgtgtatagttttggggttgttcttgtagagctcataactggg 718