Miyakogusa Predicted Gene
- Lj1g3v3767250.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v3767250.1 Non Chatacterized Hit- tr|I1LXC5|I1LXC5_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.4019
PE=,74.93,0,Pkinase,Protein kinase, catalytic domain; Serine/Threonine
protein kinases, catalytic,Serine/threoni,CUFF.31172.1
(1193 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO010898 similar to UniRef100_Q2HV99 Cluster: Protein k... 58 1e-07
gnl|LJGI|TC81715 similar to UniRef100_Q2HV72 Cluster: Protein ki... 54 2e-06
>gnl|LJGI|GO010898 similar to UniRef100_Q2HV99 Cluster: Protein kinase; Type I EGF;
n=1; Medicago truncatula|Rep: Protein kinase; Type I EGF
- Medicago truncatula (Barrel medic), partial (29%)
Length = 665
Score = 58.0 bits (29), Expect = 1e-07
Identities = 89/109 (81%)
Strand = Plus / Plus
Query: 250 gagcaattcattaatgaggtggttgttctgtcccaaatcattcataggaatgtggtcaaa 309
||||| ||||| |||||||| | || || |||||||||| |||||||||||||| ||
Sbjct: 195 gagcagttcatcaatgaggtcatcgtgctttcccaaatcaaccataggaatgtggtgaag 254
Query: 310 ctcttgggatgctgtttggagactgaagtacctttactagtttatgagt 358
||||||| || ||||| ||||| ||||| || || || ||||||||||
Sbjct: 255 atcttggggtgttgtttagagacagaagttccattgcttgtttatgagt 303
>gnl|LJGI|TC81715 similar to UniRef100_Q2HV72 Cluster: Protein kinase; n=1; Medicago
truncatula|Rep: Protein kinase - Medicago truncatula
(Barrel medic), partial (47%)
Length = 1193
Score = 54.0 bits (27), Expect = 2e-06
Identities = 45/51 (88%)
Strand = Plus / Plus
Query: 676 aaaagtgatgtatatagctttggggtagtgcttgtagagctgctaactggg 726
||||||||||| ||||| |||||||| || ||||||||||| ||||||||
Sbjct: 668 aaaagtgatgtgtatagttttggggttgttcttgtagagctcataactggg 718