Miyakogusa Predicted Gene

Lj1g3v3767180.1
Show Alignment:  
BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3767180.1 Non Chatacterized Hit- tr|I1MAA2|I1MAA2_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,75.6,0,SUBFAMILY NOT
NAMED,NULL; FAMILY NOT NAMED,NULL; Tyrosine kinase, catalytic
domain,Tyrosine-protein ,CUFF.31189.1
         (1123 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO010898 similar to UniRef100_Q2HV99 Cluster: Protein k...    82   9e-15
gnl|LJGI|TC81715 similar to UniRef100_Q2HV72 Cluster: Protein ki...    54   2e-06
gnl|LJGI|TC69011 similar to UniRef100_Q75WU3 Cluster: Leucine-ri...    52   8e-06

>gnl|LJGI|GO010898 similar to UniRef100_Q2HV99 Cluster: Protein kinase; Type I EGF;
           n=1; Medicago truncatula|Rep: Protein kinase; Type I EGF
           - Medicago truncatula (Barrel medic), partial (29%)
          Length = 665

 Score = 81.8 bits (41), Expect = 9e-15
 Identities = 68/77 (88%)
 Strand = Plus / Plus

                                                                       
Query: 280 tcccaaatcaatcataggaatgtggtcaaactcttgggatgttgtttagagactgaagtt 339
           ||||||||||| |||||||||||||| ||  ||||||| |||||||||||||| ||||||
Sbjct: 225 tcccaaatcaaccataggaatgtggtgaagatcttggggtgttgtttagagacagaagtt 284

                            
Query: 340 cctttactagtttatga 356
           || || || ||||||||
Sbjct: 285 ccattgcttgtttatga 301


>gnl|LJGI|TC81715 similar to UniRef100_Q2HV72 Cluster: Protein kinase; n=1; Medicago
           truncatula|Rep: Protein kinase - Medicago truncatula
           (Barrel medic), partial (47%)
          Length = 1193

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 670 actgagaaaagtgatgtatatagctttggggtagtgcttgtagagct 716
           ||||| ||||||||||| ||||| |||||||| || |||||||||||
Sbjct: 662 actgataaaagtgatgtgtatagttttggggttgttcttgtagagct 708


>gnl|LJGI|TC69011 similar to UniRef100_Q75WU3 Cluster: Leucine-rich repeat
           receptor-like protein kinase 1; n=1; Populus nigra|Rep:
           Leucine-rich repeat receptor-like protein kinase 1 -
           Populus nigra (Lombardy poplar), partial (17%)
          Length = 866

 Score = 52.0 bits (26), Expect = 8e-06
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 672 tgagaaaagtgatgtatatagctttggggt 701
           ||||||| ||||||||||||||||||||||
Sbjct: 409 tgagaaatgtgatgtatatagctttggggt 438