Miyakogusa Predicted Gene
- Lj1g3v3716560.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v3716560.1 Non Chatacterized Hit- tr|C0P490|C0P490_MAIZE
Uncharacterized protein OS=Zea mays PE=2 SV=1,56.41,0.74,
,NODE_28109_length_163_cov_132.061356.path3.1
(151 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC80317 homologue to UniRef100_P30075 Cluster: Chalcone... 283 1e-76
gnl|LJGI|TC78733 homologue to UniRef100_P23569 Cluster: Chalcone... 236 3e-62
gnl|LJGI|TC69074 homologue to UniRef100_P23569 Cluster: Chalcone... 236 3e-62
gnl|LJGI|TC58268 homologue to UniRef100_A1E5T0 Cluster: Chalcone... 119 5e-27
>gnl|LJGI|TC80317 homologue to UniRef100_P30075 Cluster: Chalcone synthase 4; n=1;
Medicago sativa|Rep: Chalcone synthase 4 - Medicago
sativa (Alfalfa), complete
Length = 1446
Score = 283 bits (143), Expect = 1e-76
Identities = 149/151 (98%)
Strand = Plus / Minus
Query: 1 atggctccttcactatctggagcaatagtttgtgcagtccaaactagctcaaacaaaggt 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 886 atggctccttcactatctggagcaatagtttgtgcagtccaaactagctcaaacaaaggt 827
Query: 61 ttctcaacttctggcactggatcggaaccaacaatgagtgcagctgctccgtctccgaac 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 826 ttctcaacttctggcactggatcggaaccaacaatgagtgcagctgctccgtctccgaac 767
Query: 121 aaagcttgcccaacaaggctgtctaggtgag 151
|| |||||||| |||||||||||||||||||
Sbjct: 766 aatgcttgcccgacaaggctgtctaggtgag 736
>gnl|LJGI|TC78733 homologue to UniRef100_P23569 Cluster: Chalcone synthase; n=1;
Pueraria montana var. lobata|Rep: Chalcone synthase -
Pueraria lobata (Kudzu vine), complete
Length = 1456
Score = 236 bits (119), Expect = 3e-62
Identities = 143/151 (94%)
Strand = Plus / Minus
Query: 1 atggctccttcactatctggagcaatagtttgtgcagtccaaactagctcaaacaaaggt 60
|||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 917 atggctccgtcactatctggagcaatagtttgtgcagtccaaactagttcaaacaaaggt 858
Query: 61 ttctcaacttctggcactggatcggaaccaacaatgagtgcagctgctccgtctccgaac 120
||||||| ||| ||||||||||| ||||||||||||| |||||||||||||||||||||
Sbjct: 857 ttctcaatttcaggcactggatcagaaccaacaatgaccgcagctgctccgtctccgaac 798
Query: 121 aaagcttgcccaacaaggctgtctaggtgag 151
||||||||||| |||||||||||||||||||
Sbjct: 797 aaagcttgccccacaaggctgtctaggtgag 767
>gnl|LJGI|TC69074 homologue to UniRef100_P23569 Cluster: Chalcone synthase; n=1;
Pueraria montana var. lobata|Rep: Chalcone synthase -
Pueraria lobata (Kudzu vine), complete
Length = 1394
Score = 236 bits (119), Expect = 3e-62
Identities = 143/151 (94%)
Strand = Plus / Minus
Query: 1 atggctccttcactatctggagcaatagtttgtgcagtccaaactagctcaaacaaaggt 60
|||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 834 atggctccgtcactatctggagcaatagtttgtgcagtccaaactagttcaaacaaaggt 775
Query: 61 ttctcaacttctggcactggatcggaaccaacaatgagtgcagctgctccgtctccgaac 120
||||||| ||| ||||||||||| ||||||||||||| |||||||||||||||||||||
Sbjct: 774 ttctcaatttcaggcactggatcagaaccaacaatgaccgcagctgctccgtctccgaac 715
Query: 121 aaagcttgcccaacaaggctgtctaggtgag 151
||||||||||| |||||||||||||||||||
Sbjct: 714 aaagcttgccccacaaggctgtctaggtgag 684
>gnl|LJGI|TC58268 homologue to UniRef100_A1E5T0 Cluster: Chalcone synthase 4; n=1;
Astragalus membranaceus var. mongholicus|Rep: Chalcone
synthase 4 - Astragalus mongholicus (Huang qi)
(Astragalus membranaceus var.mongholicus), partial (85%)
Length = 826
Score = 119 bits (60), Expect = 5e-27
Identities = 72/76 (94%)
Strand = Plus / Minus
Query: 76 actggatcggaaccaacaatgagtgcagctgctccgtctccgaacaaagcttgcccaaca 135
|||||||||||||||||||||||||| |||||||| ||||| ||||| ||||||||||||
Sbjct: 823 actggatcggaaccaacaatgagtgcggctgctccatctccaaacaatgcttgcccaaca 764
Query: 136 aggctgtctaggtgag 151
||||||||||||||||
Sbjct: 763 aggctgtctaggtgag 748