Miyakogusa Predicted Gene

Lj1g3v3705080.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3705080.1 Non Chatacterized Hit- tr|I1K503|I1K503_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.30417
PE,65.38,0.089,seg,NULL,NODE_100566_length_255_cov_13.086274.path1.1
         (198 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61652                                                      115   1e-25
gnl|LJGI|TC74285 similar to UniRef100_O82314 Cluster: UPF0082 pr...    86   9e-17
gnl|LJGI|TC76195 similar to UniRef100_Q941D6 Cluster: Histone de...    74   3e-13
gnl|LJGI|TC80083                                                       50   5e-06

>gnl|LJGI|TC61652 
          Length = 768

 Score =  115 bits (58), Expect = 1e-25
 Identities = 91/103 (88%), Gaps = 1/103 (0%)
 Strand = Plus / Plus

                                                                       
Query: 97  agccattctgtatacgagatggtctgcggttttaccnnnnnnn-cctattctgtatcggt 155
           |||||||||||||||||||| | |||||||||||||        |||||||||||| |||
Sbjct: 232 agccattctgtatacgagattgcctgcggttttaccttttttttcctattctgtattggt 291

                                                      
Query: 156 gacatgccggtctagatgttgcagaagaacaattgtttgatga 198
           ||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 292 gacatgctggtctagatgttgcagaagaacaattgtttgatga 334


>gnl|LJGI|TC74285 similar to UniRef100_O82314 Cluster: UPF0082 protein At2g25830;
           n=1; Arabidopsis thaliana|Rep: UPF0082 protein At2g25830
           - Arabidopsis thaliana (Mouse-ear cress), partial (9%)
          Length = 576

 Score = 85.7 bits (43), Expect = 9e-17
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                  
Query: 23  aggttatggatcaagctatggagaaaggccttattttcattgacggttttggacc 77
           ||||||||||||||||||||||||| ||||||||||||||||| |||| ||||||
Sbjct: 106 aggttatggatcaagctatggagaatggccttattttcattgatggttctggacc 160


>gnl|LJGI|TC76195 similar to UniRef100_Q941D6 Cluster: Histone deacetylase 14; n=1;
           Arabidopsis thaliana|Rep: Histone deacetylase 14 -
           Arabidopsis thaliana (Mouse-ear cress), partial (36%)
          Length = 626

 Score = 73.8 bits (37), Expect = 3e-13
 Identities = 52/57 (91%)
 Strand = Plus / Plus

                                                                    
Query: 23  aggttatggatcaagctatggagaaaggccttattttcattgacggttttggaccaa 79
           ||||||||||||||||||||||||| || |||||||| ||||| |||| ||||||||
Sbjct: 420 aggttatggatcaagctatggagaagggacttattttaattgagggttctggaccaa 476


>gnl|LJGI|TC80083 
          Length = 1107

 Score = 50.1 bits (25), Expect = 5e-06
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 39  tatggagaaaggccttattttcattgacggttttggaccaa 79
           ||||||||| ||||||||||||||| | ||||||| |||||
Sbjct: 200 tatggagaagggccttattttcatttaaggttttgaaccaa 240