Miyakogusa Predicted Gene
- Lj1g3v3704800.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v3704800.1 Non Chatacterized Hit- tr|I1HSK7|I1HSK7_BRADI
Uncharacterized protein OS=Brachypodium distachyon
GN=,62.16,2e-19,EamA,Drug/metabolite transporter; FAMILY NOT
NAMED,NULL,NODE_29592_length_192_cov_26.578125.path1.1
(225 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC79270 similar to UniRef100_Q8LE45 Cluster: Nodulin-li... 422 e-118
gnl|LJGI|TC64276 similar to UniRef100_Q8LE45 Cluster: Nodulin-li... 375 e-104
gnl|LJGI|TC66586 similar to UniRef100_Q8LE45 Cluster: Nodulin-li... 111 2e-24
>gnl|LJGI|TC79270 similar to UniRef100_Q8LE45 Cluster: Nodulin-like protein; n=1;
Arabidopsis thaliana|Rep: Nodulin-like protein -
Arabidopsis thaliana (Mouse-ear cress), partial (22%)
Length = 335
Score = 422 bits (213), Expect = e-118
Identities = 213/213 (100%)
Strand = Plus / Plus
Query: 1 atgagcaattatgttcttgttgtctaccgtcatgttgttgcctttgttgtcatggctcct 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 118 atgagcaattatgttcttgttgtctaccgtcatgttgttgcctttgttgtcatggctcct 177
Query: 61 tttgcattgatcttggacaagaacataaggccaaagatgacattttcaatctttgtgaag 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 178 tttgcattgatcttggacaagaacataaggccaaagatgacattttcaatctttgtgaag 237
Query: 121 atagtggcactgagcttgttagagccagttattgctcagaatctgtattttttgggaatg 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 238 atagtggcactgagcttgttagagccagttattgctcagaatctgtattttttgggaatg 297
Query: 181 aagtacacaacagcaacctttgcagtttccatg 213
|||||||||||||||||||||||||||||||||
Sbjct: 298 aagtacacaacagcaacctttgcagtttccatg 330
>gnl|LJGI|TC64276 similar to UniRef100_Q8LE45 Cluster: Nodulin-like protein; n=1;
Arabidopsis thaliana|Rep: Nodulin-like protein -
Arabidopsis thaliana (Mouse-ear cress), partial (53%)
Length = 830
Score = 375 bits (189), Expect = e-104
Identities = 216/225 (96%)
Strand = Plus / Plus
Query: 1 atgagcaattatgttcttgttgtctaccgtcatgttgttgcctttgttgtcatggctcct 60
|||||||||||||||||||||||||||||||| | |||||||||||||||||||| ||||
Sbjct: 202 atgagcaattatgttcttgttgtctaccgtcacgctgttgcctttgttgtcatggttcct 261
Query: 61 tttgcattgatcttggacaagaacataaggccaaagatgacattttcaatctttgtgaag 120
||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 262 tttgcattgatcttggacaagaaaataaggccgaagatgacattttcaatctttgtgaag 321
Query: 121 atagtggcactgagcttgttagagccagttattgctcagaatctgtattttttgggaatg 180
|||||| |||||||||||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 322 atagtgttactgagcttgttagagccagttattgatcagaatctgtattatttgggaatg 381
Query: 181 aagtacacaacagcaacctttgcagtttccatgtacaatatcctt 225
|||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 382 aagtacacaacagcaacctttgcagtttccatgtacaatatcctt 426
>gnl|LJGI|TC66586 similar to UniRef100_Q8LE45 Cluster: Nodulin-like protein; n=1;
Arabidopsis thaliana|Rep: Nodulin-like protein -
Arabidopsis thaliana (Mouse-ear cress), partial (50%)
Length = 738
Score = 111 bits (56), Expect = 2e-24
Identities = 110/128 (85%)
Strand = Plus / Plus
Query: 86 taaggccaaagatgacattttcaatctttgtgaagatagtggcactgagcttgttagagc 145
||||||| ||||||||||| ||||| ||| ||||||| ||||| || ||| | ||||||
Sbjct: 258 taaggcccaagatgacattgtcaatttttatgaagattgtggcgctcagcgcgctagagc 317
Query: 146 cagttattgctcagaatctgtattttttgggaatgaagtacacaacagcaacctttgcag 205
||||||||| |||||| ||||||||||||| |||||||||||||| ||||| ||||| |
Sbjct: 318 cagttattgaccagaatttgtattttttgggcatgaagtacacaactgcaacttttgctg 377
Query: 206 tttccatg 213
|| |||||
Sbjct: 378 ttgccatg 385