Miyakogusa Predicted Gene

Lj1g3v3704800.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3704800.1 Non Chatacterized Hit- tr|I1HSK7|I1HSK7_BRADI
Uncharacterized protein OS=Brachypodium distachyon
GN=,62.16,2e-19,EamA,Drug/metabolite transporter; FAMILY NOT
NAMED,NULL,NODE_29592_length_192_cov_26.578125.path1.1
         (225 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC79270 similar to UniRef100_Q8LE45 Cluster: Nodulin-li...   422   e-118
gnl|LJGI|TC64276 similar to UniRef100_Q8LE45 Cluster: Nodulin-li...   375   e-104
gnl|LJGI|TC66586 similar to UniRef100_Q8LE45 Cluster: Nodulin-li...   111   2e-24

>gnl|LJGI|TC79270 similar to UniRef100_Q8LE45 Cluster: Nodulin-like protein; n=1;
           Arabidopsis thaliana|Rep: Nodulin-like protein -
           Arabidopsis thaliana (Mouse-ear cress), partial (22%)
          Length = 335

 Score =  422 bits (213), Expect = e-118
 Identities = 213/213 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgagcaattatgttcttgttgtctaccgtcatgttgttgcctttgttgtcatggctcct 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 118 atgagcaattatgttcttgttgtctaccgtcatgttgttgcctttgttgtcatggctcct 177

                                                                       
Query: 61  tttgcattgatcttggacaagaacataaggccaaagatgacattttcaatctttgtgaag 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 178 tttgcattgatcttggacaagaacataaggccaaagatgacattttcaatctttgtgaag 237

                                                                       
Query: 121 atagtggcactgagcttgttagagccagttattgctcagaatctgtattttttgggaatg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 238 atagtggcactgagcttgttagagccagttattgctcagaatctgtattttttgggaatg 297

                                            
Query: 181 aagtacacaacagcaacctttgcagtttccatg 213
           |||||||||||||||||||||||||||||||||
Sbjct: 298 aagtacacaacagcaacctttgcagtttccatg 330


>gnl|LJGI|TC64276 similar to UniRef100_Q8LE45 Cluster: Nodulin-like protein; n=1;
           Arabidopsis thaliana|Rep: Nodulin-like protein -
           Arabidopsis thaliana (Mouse-ear cress), partial (53%)
          Length = 830

 Score =  375 bits (189), Expect = e-104
 Identities = 216/225 (96%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgagcaattatgttcttgttgtctaccgtcatgttgttgcctttgttgtcatggctcct 60
           |||||||||||||||||||||||||||||||| | |||||||||||||||||||| ||||
Sbjct: 202 atgagcaattatgttcttgttgtctaccgtcacgctgttgcctttgttgtcatggttcct 261

                                                                       
Query: 61  tttgcattgatcttggacaagaacataaggccaaagatgacattttcaatctttgtgaag 120
           ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 262 tttgcattgatcttggacaagaaaataaggccgaagatgacattttcaatctttgtgaag 321

                                                                       
Query: 121 atagtggcactgagcttgttagagccagttattgctcagaatctgtattttttgggaatg 180
           ||||||  |||||||||||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 322 atagtgttactgagcttgttagagccagttattgatcagaatctgtattatttgggaatg 381

                                                        
Query: 181 aagtacacaacagcaacctttgcagtttccatgtacaatatcctt 225
           |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 382 aagtacacaacagcaacctttgcagtttccatgtacaatatcctt 426


>gnl|LJGI|TC66586 similar to UniRef100_Q8LE45 Cluster: Nodulin-like protein; n=1;
           Arabidopsis thaliana|Rep: Nodulin-like protein -
           Arabidopsis thaliana (Mouse-ear cress), partial (50%)
          Length = 738

 Score =  111 bits (56), Expect = 2e-24
 Identities = 110/128 (85%)
 Strand = Plus / Plus

                                                                       
Query: 86  taaggccaaagatgacattttcaatctttgtgaagatagtggcactgagcttgttagagc 145
           ||||||| ||||||||||| ||||| ||| ||||||| ||||| || |||  | ||||||
Sbjct: 258 taaggcccaagatgacattgtcaatttttatgaagattgtggcgctcagcgcgctagagc 317

                                                                       
Query: 146 cagttattgctcagaatctgtattttttgggaatgaagtacacaacagcaacctttgcag 205
           |||||||||  |||||| ||||||||||||| |||||||||||||| ||||| ||||| |
Sbjct: 318 cagttattgaccagaatttgtattttttgggcatgaagtacacaactgcaacttttgctg 377

                   
Query: 206 tttccatg 213
           || |||||
Sbjct: 378 ttgccatg 385