Miyakogusa Predicted Gene

Lj1g3v3646480.2

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3646480.2 tr|B9GI56|B9GI56_POPTR Predicted protein
OS=Populus trichocarpa GN=POPTRDRAFT_641633 PE=4 SV=1,82.69,0,FAMILY
NOT NAMED,NULL; coiled-coil,NULL; DUF260,Lateral organ boundaries,
LOB; LOB,Lateral organ bou,CUFF.31030.2
         (496 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC65851 similar to UniRef100_Q9FML4 Cluster: Protein LA...   305   1e-82
gnl|LJGI|FS326366 similar to UniRef100_Q9FML4 Cluster: Protein L...   200   6e-51
gnl|LJGI|TC70595 UniRef100_Q4VPE8 Cluster: Lateral organ boundar...    76   2e-13

>gnl|LJGI|TC65851 similar to UniRef100_Q9FML4 Cluster: Protein LATERAL ORGAN
           BOUNDARIES; n=1; Arabidopsis thaliana|Rep: Protein
           LATERAL ORGAN BOUNDARIES - Arabidopsis thaliana
           (Mouse-ear cress), partial (60%)
          Length = 1201

 Score =  305 bits (154), Expect = 1e-82
 Identities = 294/340 (86%), Gaps = 3/340 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcttcttctagctactcaaac---tctccctgtgctgcctgcaagtttttgagaagg 57
           ||||| ||||||||||| || |||   |||||||||||||||||||||||| ||||||||
Sbjct: 418 atggcctcttctagctattccaacaattctccctgtgctgcctgcaagtttctgagaagg 477

                                                                       
Query: 58  aagtgcatgccggattgcatttttgccccatatttcccaccagaagagcctcacaagttt 117
           || || ||| | |||||||||||  |||| || |||||||||||||||||||||||||||
Sbjct: 478 aaatgtatgtcagattgcattttctccccttacttcccaccagaagagcctcacaagttt 537

                                                                       
Query: 118 tccaatgttcacaagatatttggtgcaagcaacgtgagtaagcttctcaatgaagtccaa 177
              |||||||||||||||||||| |||||||||||||| ||| | ||||| |||||||  
Sbjct: 538 gtgaatgttcacaagatatttggagcaagcaacgtgagcaagatcctcaacgaagtcctg 597

                                                                       
Query: 178 ccccatcaaagagaggatgcagtgaactctttagcttatgaagccgaggcacggattaaa 237
           |||||||| || |||||||||||||||||| | || || |||||||| || || || |||
Sbjct: 598 ccccatcagagggaggatgcagtgaactctctggcctacgaagccgaagcgcgcatcaaa 657

                                                                       
Query: 238 gatccagtttatggctgtgttggagccatttcagtgctccaaaggcaagtgcttaggctc 297
           ||||| ||||||||||||||||| ||||| || ||||||||||| ||||| |||||||||
Sbjct: 658 gatcctgtttatggctgtgttggggccatctctgtgctccaaagacaagtccttaggctc 717

                                                   
Query: 298 caaaaggaacttgatgcaacaaatgcagatttgattcgct 337
           |||||||||||||||||  |||| || |||||||| ||||
Sbjct: 718 caaaaggaacttgatgctgcaaacgctgatttgatccgct 757


>gnl|LJGI|FS326366 similar to UniRef100_Q9FML4 Cluster: Protein LATERAL ORGAN
           BOUNDARIES; n=1; Arabidopsis thaliana|Rep: Protein
           LATERAL ORGAN BOUNDARIES - Arabidopsis thaliana
           (Mouse-ear cress), partial (42%)
          Length = 653

 Score =  200 bits (101), Expect = 6e-51
 Identities = 196/227 (86%), Gaps = 3/227 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcttcttctagctactcaaac---tctccctgtgctgcctgcaagtttttgagaagg 57
           ||||| ||||||||||| || |||   |||||||||||||||||||||||| ||||||||
Sbjct: 417 atggcctcttctagctattccaacaattctccctgtgctgcctgcaagtttctgagaagg 476

                                                                       
Query: 58  aagtgcatgccggattgcatttttgccccatatttcccaccagaagagcctcacaagttt 117
           || || ||| | |||||||||||  |||| || |||||||||||||||||||||||||||
Sbjct: 477 aaatgtatgtcagattgcattttctccccttacttcccaccagaagagcctcacaagttt 536

                                                                       
Query: 118 tccaatgttcacaagatatttggtgcaagcaacgtgagtaagcttctcaatgaagtccaa 177
              |||||||||||||||||||| |||||||||||||| ||| | ||||| |||||||  
Sbjct: 537 gtgaatgttcacaagatatttggagcaagcaacgtgagcaagatcctcaacgaagtcctg 596

                                                          
Query: 178 ccccatcaaagagaggatgcagtgaactctttagcttatgaagccga 224
           |||||||| || |||||||||||||||||| | || || ||||||||
Sbjct: 597 ccccatcagagggaggatgcagtgaactctctggcctacgaagccga 643


>gnl|LJGI|TC70595 UniRef100_Q4VPE8 Cluster: Lateral organ boundaries-like 3; n=1;
           Lotus japonicus|Rep: Lateral organ boundaries-like 3 -
           Lotus japonicus, complete
          Length = 946

 Score = 75.8 bits (38), Expect = 2e-13
 Identities = 110/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 37  gcctgcaagtttttgagaaggaagtgcatgccggattgcatttttgccccatatttccca 96
           |||||||| ||  |||| |||||||||||||| |  ||||| ||||| ||||| || |||
Sbjct: 7   gcctgcaaattcctgaggaggaagtgcatgccagggtgcatctttgcaccatactttcca 66

                                                                       
Query: 97  ccagaagagcctcacaagttttccaatgttcacaagatatttggtgcaagcaacgtgagt 156
           || |||||||| || || ||  |||| || |||||||| |||||||| |||||||| |  
Sbjct: 67  ccggaagagccacagaaattcgccaacgtgcacaagatctttggtgcgagcaacgttacc 126

                         
Query: 157 aagcttctcaatga 170
           ||||||||||||||
Sbjct: 127 aagcttctcaatga 140