Miyakogusa Predicted Gene

Lj1g3v3556860.1
Show Alignment: 
BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3556860.1 tr|Q6BWU4|Q6BWU4_DEBHA DEHA2B08492p
OS=Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / JCM
1990,30.88,1.4, ,CUFF.30843.1
         (460 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW597419                                                      70   1e-11

>gnl|LJGI|BW597419 
          Length = 471

 Score = 69.9 bits (35), Expect = 1e-11
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                             
Query: 1  atgtttacatgtctctctccgcataaaaattcagc 35
          |||||||||||||||||||||||||||||||||||
Sbjct: 35 atgtttacatgtctctctccgcataaaaattcagc 1