Miyakogusa Predicted Gene

Lj1g3v3556830.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3556830.1 Non Chatacterized Hit- tr|F6HKN9|F6HKN9_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,21.53,4e-18,PPR,Pentatricopeptide repeat; PPR: pentatricopeptide
repeat domain,Pentatricopeptide repeat; seg,NUL,CUFF.30840.1
         (1692 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC597968 similar to UniRef100_A2Q222 Cluster: Tetratric...    56   7e-07

>gnl|LJGI|DC597968 similar to UniRef100_A2Q222 Cluster: Tetratricopeptide-like
           helical; n=1; Medicago truncatula|Rep:
           Tetratricopeptide-like helical - Medicago truncatula
           (Barrel medic), partial (26%)
          Length = 566

 Score = 56.0 bits (28), Expect = 7e-07
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 940 ctgattgatatgtatgccaaatgtgggagcat 971
           ||||||| ||||||||||||||||||||||||
Sbjct: 525 ctgattgctatgtatgccaaatgtgggagcat 556