Miyakogusa Predicted Gene

Lj1g3v3443840.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3443840.1 Non Chatacterized Hit- tr|J3NKM8|J3NKM8_GAGT3
Uncharacterized protein OS=Gaeumannomyces graminis
var,35.19,4.8,seg,NULL,CUFF.30728.1
         (385 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW607313 homologue to UniRef100_Q43877 Cluster: HMGI/Y;...   408   e-113

>gnl|LJGI|BW607313 homologue to UniRef100_Q43877 Cluster: HMGI/Y; n=2; Pisum
           sativum|Rep: HMGI/Y - Pisum sativum (Garden pea),
           partial (6%)
          Length = 487

 Score =  408 bits (206), Expect = e-113
 Identities = 263/282 (93%)
 Strand = Plus / Minus

                                                                       
Query: 104 ggcctcggggaagtcccaagaattctgagaaaggaggtggaaagaagtctagccagactg 163
           ||||||||||||| |||||||| |||| || |||||||||||||||||||||||||||||
Sbjct: 414 ggcctcggggaaggcccaagaactctgggagaggaggtggaaagaagtctagccagactg 355

                                                                       
Query: 164 atagctccaatgggactgggtcattggaaggagttggttcggagtcaacagggagagagc 223
            ||||||  |||||| ||||||| ||||||||||||| ||||||||||||||| | ||||
Sbjct: 354 ttagctcgtatgggattgggtcaatggaaggagttgggtcggagtcaacagggggtgagc 295

                                                                       
Query: 224 tgttggtgctaccggcagagctatcaaatccttatggagtcttgaccagagcacgaaatg 283
           |||||||||||||||||||||| || ||||||||||||||||||||||||||||| | ||
Sbjct: 294 tgttggtgctaccggcagagctgtcgaatccttatggagtcttgaccagagcacgtagtg 235

                                                                       
Query: 284 ccttgttgatggggaagcggttgggcatggagtatgattgctcagattctgttgccctct 343
           ||||||||||||||| |||| |||||||||||||||||||||||||||| ||||||||||
Sbjct: 234 ccttgttgatggggaggcggctgggcatggagtatgattgctcagattcggttgccctct 175

                                                     
Query: 344 cccagattgcttctcaaatcatggcgagaaggtcttcttagg 385
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 174 cccagattgcttctcaaatcatggcgagaaggtcttcttagg 133