Miyakogusa Predicted Gene

Lj1g3v3384600.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3384600.1 Non Chatacterized Hit- tr|K4BAM3|K4BAM3_SOLLC
Uncharacterized protein OS=Solanum lycopersicum GN=Sol,46.6,3e-19,no
description,NULL; HMA_2,Heavy metal-associated domain, HMA; HMA, heavy
metal-associated domain,He,CUFF.30588.1
         (555 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC62378 similar to UniRef100_Q8LGG1 Cluster: Farnesylat...   155   3e-37
gnl|LJGI|TC67493 similar to UniRef100_Q8LGG1 Cluster: Farnesylat...   139   2e-32
gnl|LJGI|TC64057 similar to UniRef100_Q9ZRD7 Cluster: GMFP7; n=1...    60   2e-08

>gnl|LJGI|TC62378 similar to UniRef100_Q8LGG1 Cluster: Farnesylated protein; n=1;
           Arabidopsis thaliana|Rep: Farnesylated protein -
           Arabidopsis thaliana (Mouse-ear cress), complete
          Length = 693

 Score =  155 bits (78), Expect = 3e-37
 Identities = 249/305 (81%), Gaps = 12/305 (3%)
 Strand = Plus / Plus

                                                                       
Query: 106 agattcacaaaaatgggtgcttccagtcacaactctgacctcattgactgctccagcgga 165
           ||||| |||||||||||||||     ||||| |||||| ||| |||||||||||||||||
Sbjct: 63  agatttacaaaaatgggtgctcttgatcacatctctgatctctttgactgctccagcgga 122

                                                                       
Query: 166 agttc---caaaaagc------aattgcagacggtggaggtgaaagtgagaatggactgc 216
           |||||   |||||| |      |||||||||||||||||||||||||||  |||||||||
Sbjct: 123 agttcacacaaaaaacgcaaacaattgcagacggtggaggtgaaagtgaagatggactgc 182

                                                                       
Query: 217 tgcgaggcatgtgtgaagaaggtcaggaaggcagtcaagggtatggaaggggtaaactcc 276
              || | ||| | || |||||| |||||||| ||  |||||||| |||| || ||||| 
Sbjct: 183 ---gacggatgcgagaggaaggtgaggaaggcggtggagggtatgaaaggagtgaactcg 239

                                                                       
Query: 277 gttgagattgagcgcgaggcaaacaagctcaccgttactggctatgttgaaccctctgat 336
           || || ||||||||| |||| | |||| ||||||||||||| ||||| ||||||    | 
Sbjct: 240 gtggatattgagcgcaaggccagcaaggtcaccgttactgggtatgtggaacccaacaag 299

                                                                       
Query: 337 gtcgtgtcccgcatcgctcaccgcactgggaataaggcagagatcttgtcctatgtttca 396
           || ||||||||||||||||||| ||||||||| ||||||||||||| | |||||||| ||
Sbjct: 300 gttgtgtcccgcatcgctcaccacactgggaaaaaggcagagatctggccctatgttcca 359

                
Query: 397 tacga 401
           |||||
Sbjct: 360 tacga 364


>gnl|LJGI|TC67493 similar to UniRef100_Q8LGG1 Cluster: Farnesylated protein; n=1;
           Arabidopsis thaliana|Rep: Farnesylated protein -
           Arabidopsis thaliana (Mouse-ear cress), complete
          Length = 788

 Score =  139 bits (70), Expect = 2e-32
 Identities = 183/220 (83%), Gaps = 3/220 (1%)
 Strand = Plus / Plus

                                                                       
Query: 182 tgcagacggtggaggtgaaagtgagaatggactgctgcgaggcatgtgtgaagaaggtca 241
           ||||||||||||||||||||||||  |||||||||   || | ||| | || |||||| |
Sbjct: 243 tgcagacggtggaggtgaaagtgaagatggactgc---gacggatgcgagaggaaggtga 299

                                                                       
Query: 242 ggaaggcagtcaagggtatggaaggggtaaactccgttgagattgagcgcgaggcaaaca 301
           ||||||| ||  |||||||| |||| || ||||| || || ||||||||| |||| | ||
Sbjct: 300 ggaaggcggtggagggtatgaaaggagtgaactcggtggatattgagcgcaaggccagca 359

                                                                       
Query: 302 agctcaccgttactggctatgttgaaccctctgatgtcgtgtcccgcatcgctcaccgca 361
           || ||||||||||||| ||||| ||||||    | || ||||||||||||||||||| ||
Sbjct: 360 aggtcaccgttactgggtatgtggaacccaacaaggttgtgtcccgcatcgctcaccaca 419

                                                   
Query: 362 ctgggaataaggcagagatcttgtcctatgtttcatacga 401
           ||||||| ||||||||||||| | |||||||| |||||||
Sbjct: 420 ctgggaaaaaggcagagatctggccctatgttccatacga 459



 Score = 58.0 bits (29), Expect = 6e-08
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 106 agattcacaaaaatgggtgcttccagtcacaactctgacctcattgactgctccagcgga 165
           ||||| |||||||||||||||     ||||| |||||| ||| |||||||||||||||||
Sbjct: 62  agatttacaaaaatgggtgctcttgatcacatctctgatctctttgactgctccagcgga 121

                
Query: 166 agttc 170
           |||||
Sbjct: 122 agttc 126


>gnl|LJGI|TC64057 similar to UniRef100_Q9ZRD7 Cluster: GMFP7; n=1; Glycine max|Rep:
           GMFP7 - Glycine max (Soybean), partial (98%)
          Length = 794

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 175 aagcaattgcagacggtggaggtgaaagtgagaatggactgc 216
           |||||||| ||||||||||||||||||||||  |||||||||
Sbjct: 129 aagcaattccagacggtggaggtgaaagtgaagatggactgc 170