Miyakogusa Predicted Gene
- Lj1g3v3384600.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v3384600.1 Non Chatacterized Hit- tr|K4BAM3|K4BAM3_SOLLC
Uncharacterized protein OS=Solanum lycopersicum GN=Sol,46.6,3e-19,no
description,NULL; HMA_2,Heavy metal-associated domain, HMA; HMA, heavy
metal-associated domain,He,CUFF.30588.1
(555 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC62378 similar to UniRef100_Q8LGG1 Cluster: Farnesylat... 155 3e-37
gnl|LJGI|TC67493 similar to UniRef100_Q8LGG1 Cluster: Farnesylat... 139 2e-32
gnl|LJGI|TC64057 similar to UniRef100_Q9ZRD7 Cluster: GMFP7; n=1... 60 2e-08
>gnl|LJGI|TC62378 similar to UniRef100_Q8LGG1 Cluster: Farnesylated protein; n=1;
Arabidopsis thaliana|Rep: Farnesylated protein -
Arabidopsis thaliana (Mouse-ear cress), complete
Length = 693
Score = 155 bits (78), Expect = 3e-37
Identities = 249/305 (81%), Gaps = 12/305 (3%)
Strand = Plus / Plus
Query: 106 agattcacaaaaatgggtgcttccagtcacaactctgacctcattgactgctccagcgga 165
||||| ||||||||||||||| ||||| |||||| ||| |||||||||||||||||
Sbjct: 63 agatttacaaaaatgggtgctcttgatcacatctctgatctctttgactgctccagcgga 122
Query: 166 agttc---caaaaagc------aattgcagacggtggaggtgaaagtgagaatggactgc 216
||||| |||||| | ||||||||||||||||||||||||||| |||||||||
Sbjct: 123 agttcacacaaaaaacgcaaacaattgcagacggtggaggtgaaagtgaagatggactgc 182
Query: 217 tgcgaggcatgtgtgaagaaggtcaggaaggcagtcaagggtatggaaggggtaaactcc 276
|| | ||| | || |||||| |||||||| || |||||||| |||| || |||||
Sbjct: 183 ---gacggatgcgagaggaaggtgaggaaggcggtggagggtatgaaaggagtgaactcg 239
Query: 277 gttgagattgagcgcgaggcaaacaagctcaccgttactggctatgttgaaccctctgat 336
|| || ||||||||| |||| | |||| ||||||||||||| ||||| |||||| |
Sbjct: 240 gtggatattgagcgcaaggccagcaaggtcaccgttactgggtatgtggaacccaacaag 299
Query: 337 gtcgtgtcccgcatcgctcaccgcactgggaataaggcagagatcttgtcctatgtttca 396
|| ||||||||||||||||||| ||||||||| ||||||||||||| | |||||||| ||
Sbjct: 300 gttgtgtcccgcatcgctcaccacactgggaaaaaggcagagatctggccctatgttcca 359
Query: 397 tacga 401
|||||
Sbjct: 360 tacga 364
>gnl|LJGI|TC67493 similar to UniRef100_Q8LGG1 Cluster: Farnesylated protein; n=1;
Arabidopsis thaliana|Rep: Farnesylated protein -
Arabidopsis thaliana (Mouse-ear cress), complete
Length = 788
Score = 139 bits (70), Expect = 2e-32
Identities = 183/220 (83%), Gaps = 3/220 (1%)
Strand = Plus / Plus
Query: 182 tgcagacggtggaggtgaaagtgagaatggactgctgcgaggcatgtgtgaagaaggtca 241
|||||||||||||||||||||||| ||||||||| || | ||| | || |||||| |
Sbjct: 243 tgcagacggtggaggtgaaagtgaagatggactgc---gacggatgcgagaggaaggtga 299
Query: 242 ggaaggcagtcaagggtatggaaggggtaaactccgttgagattgagcgcgaggcaaaca 301
||||||| || |||||||| |||| || ||||| || || ||||||||| |||| | ||
Sbjct: 300 ggaaggcggtggagggtatgaaaggagtgaactcggtggatattgagcgcaaggccagca 359
Query: 302 agctcaccgttactggctatgttgaaccctctgatgtcgtgtcccgcatcgctcaccgca 361
|| ||||||||||||| ||||| |||||| | || ||||||||||||||||||| ||
Sbjct: 360 aggtcaccgttactgggtatgtggaacccaacaaggttgtgtcccgcatcgctcaccaca 419
Query: 362 ctgggaataaggcagagatcttgtcctatgtttcatacga 401
||||||| ||||||||||||| | |||||||| |||||||
Sbjct: 420 ctgggaaaaaggcagagatctggccctatgttccatacga 459
Score = 58.0 bits (29), Expect = 6e-08
Identities = 56/65 (86%)
Strand = Plus / Plus
Query: 106 agattcacaaaaatgggtgcttccagtcacaactctgacctcattgactgctccagcgga 165
||||| ||||||||||||||| ||||| |||||| ||| |||||||||||||||||
Sbjct: 62 agatttacaaaaatgggtgctcttgatcacatctctgatctctttgactgctccagcgga 121
Query: 166 agttc 170
|||||
Sbjct: 122 agttc 126
>gnl|LJGI|TC64057 similar to UniRef100_Q9ZRD7 Cluster: GMFP7; n=1; Glycine max|Rep:
GMFP7 - Glycine max (Soybean), partial (98%)
Length = 794
Score = 60.0 bits (30), Expect = 2e-08
Identities = 39/42 (92%)
Strand = Plus / Plus
Query: 175 aagcaattgcagacggtggaggtgaaagtgagaatggactgc 216
|||||||| |||||||||||||||||||||| |||||||||
Sbjct: 129 aagcaattccagacggtggaggtgaaagtgaagatggactgc 170