Miyakogusa Predicted Gene

Lj1g3v3329970.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3329970.1 Non Chatacterized Hit- tr|I1JSB1|I1JSB1_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.35760
PE,74.73,0,CYCLINS,Cyclin, N-terminal; domain present in cyclins,
TFIIB and Retinob,Cyclin-like; seg,NULL; no d,CUFF.30450.1
         (1092 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61274 similar to UniRef100_P46277 Cluster: G2/mitotic...    72   8e-12
gnl|LJGI|TC58240 similar to UniRef100_P46277 Cluster: G2/mitotic...    52   7e-06

>gnl|LJGI|TC61274 similar to UniRef100_P46277 Cluster: G2/mitotic-specific cyclin-1;
           n=1; Medicago sativa subsp. x varia|Rep:
           G2/mitotic-specific cyclin-1 - Medicago varia (Alfalfa),
           partial (35%)
          Length = 737

 Score = 71.9 bits (36), Expect = 8e-12
 Identities = 99/120 (82%)
 Strand = Plus / Plus

                                                                       
Query: 634 gacaaggcatacacaagaaatgaagttttgaatatggagaagctaatggtgaacaccttg 693
           ||||| |||||| |||| || ||||||||| | ||||||||||| ||||||||||| |||
Sbjct: 1   gacaaagcatactcaaggaaagaagttttggaaatggagaagctgatggtgaacacattg 60

                                                                       
Query: 694 caattcaacttgtctgtgcctactccgtatgtgtttatgagaagatttcttaaggcagct 753
            | |||||  |||||||||| ||  | ||||| || |||||||| || || |||||||||
Sbjct: 61  gagttcaatatgtctgtgccaacagcatatgttttcatgagaaggttcctaaaggcagct 120


>gnl|LJGI|TC58240 similar to UniRef100_P46277 Cluster: G2/mitotic-specific cyclin-1;
           n=1; Medicago sativa subsp. x varia|Rep:
           G2/mitotic-specific cyclin-1 - Medicago varia (Alfalfa),
           partial (43%)
          Length = 874

 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 399 tgacattaatgagaagatgagggccattcttatggactggcttattgaggttcactataa 458
           |||||||||||| | |||||| || || || || ||||||||||||||||| ||| | ||
Sbjct: 798 tgacattaatgaaaggatgagagctatactgattgactggcttattgaggtccacgacaa 857

                 
Query: 459 atttga 464
           ||||||
Sbjct: 858 atttga 863