Miyakogusa Predicted Gene

Lj1g3v3207800.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3207800.1 Non Chatacterized Hit- tr|I1JDR9|I1JDR9_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,90.57,0,MIP,Major
intrinsic protein; Aquaporin-like,Aquaporin-like; no
description,Aquaporin-like; SUBFAMILY,CUFF.30186.1
         (483 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP029555 similar to UniRef100_O82598 Cluster: Aquaporin...   281   2e-75
gnl|LJGI|TC57197 similar to UniRef100_Q39883 Cluster: Nodulin-26...   246   1e-64
gnl|LJGI|GO030028 similar to UniRef100_Q39883 Cluster: Nodulin-2...   234   4e-61
gnl|LJGI|BW596211 UniRef100_Q9LKJ6 Cluster: Water-selective tran...    56   2e-07
gnl|LJGI|TC75403 UniRef100_Q9LKJ6 Cluster: Water-selective trans...    56   2e-07

>gnl|LJGI|BP029555 similar to UniRef100_O82598 Cluster: Aquaporin TIP1-3; n=1;
           Arabidopsis thaliana|Rep: Aquaporin TIP1-3 - Arabidopsis
           thaliana (Mouse-ear cress), partial (18%)
          Length = 360

 Score =  281 bits (142), Expect = 2e-75
 Identities = 142/142 (100%)
 Strand = Plus / Minus

                                                                       
Query: 342 tgttgttagctggacctggactcatcactgggtctattgggctggcccattcatgggagc 401
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 360 tgttgttagctggacctggactcatcactgggtctattgggctggcccattcatgggagc 301

                                                                       
Query: 402 agcacttgcggccattatttatgataatatcttcattggtgatgatggtcatgaacccct 461
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 300 agcacttgcggccattatttatgataatatcttcattggtgatgatggtcatgaacccct 241

                                 
Query: 462 cacaaacagtgatttctagatt 483
           ||||||||||||||||||||||
Sbjct: 240 cacaaacagtgatttctagatt 219


>gnl|LJGI|TC57197 similar to UniRef100_Q39883 Cluster: Nodulin-26; n=1; Glycine
           max|Rep: Nodulin-26 - Glycine max (Soybean), partial
           (98%)
          Length = 1052

 Score =  246 bits (124), Expect = 1e-64
 Identities = 298/356 (83%)
 Strand = Plus / Plus

                                                                       
Query: 34  ttgtattggattgctcagttgcttggttcagttgttgcttgcatcctcctcaagtctgca 93
           |||||||||||||||||||||||||| || || ||||||||| | |||||||| | ||| 
Sbjct: 407 ttgtattggattgctcagttgcttggctctgtggttgcttgcttgctcctcaaatttgcc 466

                                                                       
Query: 94  actggtggaatggaaacatcagcttttgctctatcctctggggtgtctgtgtggaatgca 153
           ||||| ||| ||||||| || || ||  |  | || ||||| |||   |  |  ||||||
Sbjct: 467 actgggggattggaaacttctgcattctcattgtcttctggtgtgggagcatcaaatgca 526

                                                                       
Query: 154 ctagtttttgaaattgtgatgacatttgggttggtatacacagtttatgccacagcagtg 213
           || || ||||| ||||||||||| ||||| ||||| ||||| || |||||||| ||||||
Sbjct: 527 cttgtctttgagattgtgatgacttttggtttggtttacactgtgtatgccactgcagtg 586

                                                                       
Query: 214 gatccaaagaaagggaatgtgggcattgttgctccaattgccattggttttcttgtggga 273
           ||||||||||| ||  |  | || ||| ||||||||||||||||||||||  ||||||||
Sbjct: 587 gatccaaagaagggtgacatcgggattattgctccaattgccattggtttcattgtggga 646

                                                                       
Query: 274 gccaatatcttagttggtggtgcttttgatggtgcatcaatgaacccagctgtgtccttt 333
           || || ||||| |  |||||||| |||||||||||||| ||||||||||| ||||| |||
Sbjct: 647 gctaacatcttggcaggtggtgcctttgatggtgcatccatgaacccagcagtgtctttt 706

                                                                   
Query: 334 gggcctgctgttgttagctggacctggactcatcactgggtctattgggctggccc 389
           ||||| || ||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 707 gggcccgcagttgttagctggacctggactaatcactgggtctattgggctggccc 762


>gnl|LJGI|GO030028 similar to UniRef100_Q39883 Cluster: Nodulin-26; n=1; Glycine
           max|Rep: Nodulin-26 - Glycine max (Soybean), partial
           (53%)
          Length = 717

 Score =  234 bits (118), Expect = 4e-61
 Identities = 211/242 (87%)
 Strand = Plus / Minus

                                                                       
Query: 148 aatgcactagtttttgaaattgtgatgacatttgggttggtatacacagtttatgccaca 207
           |||||||| || ||||| ||||||||||| ||||| ||||| ||||| || |||||||| 
Sbjct: 628 aatgcacttgtctttgagattgtgatgacttttggtttggtttacactgtgtatgccact 569

                                                                       
Query: 208 gcagtggatccaaagaaagggaatgtgggcattgttgctccaattgccattggttttctt 267
           ||||||||||||||||| ||  |  | || ||| ||||||||||||||||||||||  ||
Sbjct: 568 gcagtggatccaaagaagggtgacatcgggattattgctccaattgccattggtttcatt 509

                                                                       
Query: 268 gtgggagccaatatcttagttggtggtgcttttgatggtgcatcaatgaacccagctgtg 327
           |||||||| || ||||| |  |||||||| |||||||||||||| ||||||||||| |||
Sbjct: 508 gtgggagctaacatcttggcaggtggtgcctttgatggtgcatccatgaacccagcagtg 449

                                                                       
Query: 328 tcctttgggcctgctgttgttagctggacctggactcatcactgggtctattgggctggc 387
           || |||||||| || ||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 448 tcttttgggcccgcagttgttagctggacctggactaatcactgggtctattgggctggc 389

             
Query: 388 cc 389
           ||
Sbjct: 388 cc 387


>gnl|LJGI|BW596211 UniRef100_Q9LKJ6 Cluster: Water-selective transport intrinsic
           membrane protein 1; n=1; Lotus japonicus|Rep:
           Water-selective transport intrinsic membrane protein 1 -
           Lotus japonicus, partial (42%)
          Length = 469

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 169 gtgatgacatttgggttggtatacacagtttatgccacagcagtggatccaaagaa 224
           |||||||| ||||| ||||| ||||||||||| |||||||| || ||||| |||||
Sbjct: 366 gtgatgacctttggattggtgtacacagtttacgccacagccgttgatcccaagaa 421


>gnl|LJGI|TC75403 UniRef100_Q9LKJ6 Cluster: Water-selective transport intrinsic
           membrane protein 1; n=1; Lotus japonicus|Rep:
           Water-selective transport intrinsic membrane protein 1 -
           Lotus japonicus, complete
          Length = 1178

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 169 gtgatgacatttgggttggtatacacagtttatgccacagcagtggatccaaagaa 224
           |||||||| ||||| ||||| ||||||||||| |||||||| || ||||| |||||
Sbjct: 548 gtgatgacctttggattggtgtacacagtttacgccacagccgttgatcccaagaa 603