Miyakogusa Predicted Gene
- Lj1g3v3207800.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v3207800.1 Non Chatacterized Hit- tr|I1JDR9|I1JDR9_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,90.57,0,MIP,Major
intrinsic protein; Aquaporin-like,Aquaporin-like; no
description,Aquaporin-like; SUBFAMILY,CUFF.30186.1
(483 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP029555 similar to UniRef100_O82598 Cluster: Aquaporin... 281 2e-75
gnl|LJGI|TC57197 similar to UniRef100_Q39883 Cluster: Nodulin-26... 246 1e-64
gnl|LJGI|GO030028 similar to UniRef100_Q39883 Cluster: Nodulin-2... 234 4e-61
gnl|LJGI|BW596211 UniRef100_Q9LKJ6 Cluster: Water-selective tran... 56 2e-07
gnl|LJGI|TC75403 UniRef100_Q9LKJ6 Cluster: Water-selective trans... 56 2e-07
>gnl|LJGI|BP029555 similar to UniRef100_O82598 Cluster: Aquaporin TIP1-3; n=1;
Arabidopsis thaliana|Rep: Aquaporin TIP1-3 - Arabidopsis
thaliana (Mouse-ear cress), partial (18%)
Length = 360
Score = 281 bits (142), Expect = 2e-75
Identities = 142/142 (100%)
Strand = Plus / Minus
Query: 342 tgttgttagctggacctggactcatcactgggtctattgggctggcccattcatgggagc 401
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 360 tgttgttagctggacctggactcatcactgggtctattgggctggcccattcatgggagc 301
Query: 402 agcacttgcggccattatttatgataatatcttcattggtgatgatggtcatgaacccct 461
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 300 agcacttgcggccattatttatgataatatcttcattggtgatgatggtcatgaacccct 241
Query: 462 cacaaacagtgatttctagatt 483
||||||||||||||||||||||
Sbjct: 240 cacaaacagtgatttctagatt 219
>gnl|LJGI|TC57197 similar to UniRef100_Q39883 Cluster: Nodulin-26; n=1; Glycine
max|Rep: Nodulin-26 - Glycine max (Soybean), partial
(98%)
Length = 1052
Score = 246 bits (124), Expect = 1e-64
Identities = 298/356 (83%)
Strand = Plus / Plus
Query: 34 ttgtattggattgctcagttgcttggttcagttgttgcttgcatcctcctcaagtctgca 93
|||||||||||||||||||||||||| || || ||||||||| | |||||||| | |||
Sbjct: 407 ttgtattggattgctcagttgcttggctctgtggttgcttgcttgctcctcaaatttgcc 466
Query: 94 actggtggaatggaaacatcagcttttgctctatcctctggggtgtctgtgtggaatgca 153
||||| ||| ||||||| || || || | | || ||||| ||| | | ||||||
Sbjct: 467 actgggggattggaaacttctgcattctcattgtcttctggtgtgggagcatcaaatgca 526
Query: 154 ctagtttttgaaattgtgatgacatttgggttggtatacacagtttatgccacagcagtg 213
|| || ||||| ||||||||||| ||||| ||||| ||||| || |||||||| ||||||
Sbjct: 527 cttgtctttgagattgtgatgacttttggtttggtttacactgtgtatgccactgcagtg 586
Query: 214 gatccaaagaaagggaatgtgggcattgttgctccaattgccattggttttcttgtggga 273
||||||||||| || | | || ||| |||||||||||||||||||||| ||||||||
Sbjct: 587 gatccaaagaagggtgacatcgggattattgctccaattgccattggtttcattgtggga 646
Query: 274 gccaatatcttagttggtggtgcttttgatggtgcatcaatgaacccagctgtgtccttt 333
|| || ||||| | |||||||| |||||||||||||| ||||||||||| ||||| |||
Sbjct: 647 gctaacatcttggcaggtggtgcctttgatggtgcatccatgaacccagcagtgtctttt 706
Query: 334 gggcctgctgttgttagctggacctggactcatcactgggtctattgggctggccc 389
||||| || ||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 707 gggcccgcagttgttagctggacctggactaatcactgggtctattgggctggccc 762
>gnl|LJGI|GO030028 similar to UniRef100_Q39883 Cluster: Nodulin-26; n=1; Glycine
max|Rep: Nodulin-26 - Glycine max (Soybean), partial
(53%)
Length = 717
Score = 234 bits (118), Expect = 4e-61
Identities = 211/242 (87%)
Strand = Plus / Minus
Query: 148 aatgcactagtttttgaaattgtgatgacatttgggttggtatacacagtttatgccaca 207
|||||||| || ||||| ||||||||||| ||||| ||||| ||||| || ||||||||
Sbjct: 628 aatgcacttgtctttgagattgtgatgacttttggtttggtttacactgtgtatgccact 569
Query: 208 gcagtggatccaaagaaagggaatgtgggcattgttgctccaattgccattggttttctt 267
||||||||||||||||| || | | || ||| |||||||||||||||||||||| ||
Sbjct: 568 gcagtggatccaaagaagggtgacatcgggattattgctccaattgccattggtttcatt 509
Query: 268 gtgggagccaatatcttagttggtggtgcttttgatggtgcatcaatgaacccagctgtg 327
|||||||| || ||||| | |||||||| |||||||||||||| ||||||||||| |||
Sbjct: 508 gtgggagctaacatcttggcaggtggtgcctttgatggtgcatccatgaacccagcagtg 449
Query: 328 tcctttgggcctgctgttgttagctggacctggactcatcactgggtctattgggctggc 387
|| |||||||| || ||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 448 tcttttgggcccgcagttgttagctggacctggactaatcactgggtctattgggctggc 389
Query: 388 cc 389
||
Sbjct: 388 cc 387
>gnl|LJGI|BW596211 UniRef100_Q9LKJ6 Cluster: Water-selective transport intrinsic
membrane protein 1; n=1; Lotus japonicus|Rep:
Water-selective transport intrinsic membrane protein 1 -
Lotus japonicus, partial (42%)
Length = 469
Score = 56.0 bits (28), Expect = 2e-07
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 169 gtgatgacatttgggttggtatacacagtttatgccacagcagtggatccaaagaa 224
|||||||| ||||| ||||| ||||||||||| |||||||| || ||||| |||||
Sbjct: 366 gtgatgacctttggattggtgtacacagtttacgccacagccgttgatcccaagaa 421
>gnl|LJGI|TC75403 UniRef100_Q9LKJ6 Cluster: Water-selective transport intrinsic
membrane protein 1; n=1; Lotus japonicus|Rep:
Water-selective transport intrinsic membrane protein 1 -
Lotus japonicus, complete
Length = 1178
Score = 56.0 bits (28), Expect = 2e-07
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 169 gtgatgacatttgggttggtatacacagtttatgccacagcagtggatccaaagaa 224
|||||||| ||||| ||||| ||||||||||| |||||||| || ||||| |||||
Sbjct: 548 gtgatgacctttggattggtgtacacagtttacgccacagccgttgatcccaagaa 603