Miyakogusa Predicted Gene

Lj1g3v3137890.2

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3137890.2 Non Chatacterized Hit- tr|I1N4Y4|I1N4Y4_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,84.11,0,seg,NULL;
PROTEIN_KINASE_DOM,Protein kinase, catalytic domain; Serine/Threonine
protein kinases, cat,CUFF.30121.2
         (1257 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP053501 similar to UniRef100_A7QT70 Cluster: Chromosom...   482   e-135

>gnl|LJGI|BP053501 similar to UniRef100_A7QT70 Cluster: Chromosome chr1 scaffold_166,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr1 scaffold_166, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (21%)
          Length = 385

 Score =  482 bits (243), Expect = e-135
 Identities = 247/249 (99%)
 Strand = Plus / Minus

                                                                        
Query: 1009 gaccctacagatccattctttggagaagcagcaagtggggggagcttggggtgttggctg 1068
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 385  gaccctacagatccattctttggagaagcagcaagtggggggagcttggggtgttgnctg 326

                                                                        
Query: 1069 aggcacttgcaacaagcaggtgaagcaaaagaagctttagataagagcattttgggggaa 1128
            |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 325  aggcacttgcaacaagcaggtgaagcnaaagaagctttagataagagcattttgggggaa 266

                                                                        
Query: 1129 gaaggggaagaagatgagatgctcatggctttcaggattgctgctgcatgcctctctgat 1188
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 265  gaaggggaagaagatgagatgctcatggctttcaggattgctgctgcatgcctctctgat 206

                                                                        
Query: 1189 gtgcctgcagataggccttgtagtgatgagcttgttcacatgctaacacaactgcacagt 1248
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 205  gtgcctgcagataggccttgtagtgatgagcttgttcacatgctaacacaactgcacagt 146

                     
Query: 1249 ttttgaagc 1257
            |||||||||
Sbjct: 145  ttttgaagc 137