Miyakogusa Predicted Gene

Lj1g3v3077190.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3077190.1 Non Chatacterized Hit- tr|I1LAD8|I1LAD8_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=4,57.81,0.0000000002, ,CUFF.29997.1
         (229 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC74845 weakly similar to UniRef100_Q70WR3 Cluster: S l...    58   2e-08
gnl|LJGI|FS360471 UniRef100_Q22HI8 Cluster: Cyclic nucleotide-bi...    52   1e-06

>gnl|LJGI|TC74845 weakly similar to UniRef100_Q70WR3 Cluster: S locus F-box (SLF)-S1E
           protein; n=1; Antirrhinum hispanicum|Rep: S locus F-box
           (SLF)-S1E protein - Antirrhinum hispanicum (Snapdragon),
           partial (5%)
          Length = 888

 Score = 58.0 bits (29), Expect = 2e-08
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 5   aagattataaagtgcagtcttcttggactaaatattttgtt 45
           |||| ||||||| |||||||||||||||||||| |||||||
Sbjct: 240 aagagtataaagggcagtcttcttggactaaatcttttgtt 280


>gnl|LJGI|FS360471 UniRef100_Q22HI8 Cluster: Cyclic nucleotide-binding domain
           containing protein; n=1; Tetrahymena thermophila SB210|,
           partial (0%)
          Length = 660

 Score = 52.0 bits (26), Expect = 1e-06
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 10  tataaagtgcagtcttcttggactaa 35
           ||||||||||||||||||||||||||
Sbjct: 459 tataaagtgcagtcttcttggactaa 434