Miyakogusa Predicted Gene
- Lj1g3v3077190.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v3077190.1 Non Chatacterized Hit- tr|I1LAD8|I1LAD8_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=4,57.81,0.0000000002, ,CUFF.29997.1
(229 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC74845 weakly similar to UniRef100_Q70WR3 Cluster: S l... 58 2e-08
gnl|LJGI|FS360471 UniRef100_Q22HI8 Cluster: Cyclic nucleotide-bi... 52 1e-06
>gnl|LJGI|TC74845 weakly similar to UniRef100_Q70WR3 Cluster: S locus F-box (SLF)-S1E
protein; n=1; Antirrhinum hispanicum|Rep: S locus F-box
(SLF)-S1E protein - Antirrhinum hispanicum (Snapdragon),
partial (5%)
Length = 888
Score = 58.0 bits (29), Expect = 2e-08
Identities = 38/41 (92%)
Strand = Plus / Plus
Query: 5 aagattataaagtgcagtcttcttggactaaatattttgtt 45
|||| ||||||| |||||||||||||||||||| |||||||
Sbjct: 240 aagagtataaagggcagtcttcttggactaaatcttttgtt 280
>gnl|LJGI|FS360471 UniRef100_Q22HI8 Cluster: Cyclic nucleotide-binding domain
containing protein; n=1; Tetrahymena thermophila SB210|,
partial (0%)
Length = 660
Score = 52.0 bits (26), Expect = 1e-06
Identities = 26/26 (100%)
Strand = Plus / Minus
Query: 10 tataaagtgcagtcttcttggactaa 35
||||||||||||||||||||||||||
Sbjct: 459 tataaagtgcagtcttcttggactaa 434