Miyakogusa Predicted Gene
- Lj1g3v3074090.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v3074090.1 Non Chatacterized Hit- tr|I1MQ75|I1MQ75_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,44.9,8e-19,seg,NULL,CUFF.30007.1
(655 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC80454 similar to UniRef100_Q2HV76 Cluster: F-box prot... 125 4e-28
gnl|LJGI|BP044058 103 1e-21
gnl|LJGI|TC80159 101 5e-21
gnl|LJGI|FS360686 UniRef100_Q2LTC8 Cluster: Exodeoxyribonuclease... 94 1e-18
gnl|LJGI|TC60681 similar to UniRef100_A8I1P8 Cluster: Transcript... 86 3e-16
gnl|LJGI|TC77017 similar to UniRef100_Q2HV76 Cluster: F-box prot... 78 8e-14
gnl|LJGI|FS360471 UniRef100_Q22HI8 Cluster: Cyclic nucleotide-bi... 62 5e-09
gnl|LJGI|BP061168 62 5e-09
gnl|LJGI|TC77662 56 3e-07
gnl|LJGI|TC81377 54 1e-06
gnl|LJGI|BP040943 52 4e-06
gnl|LJGI|AI967342 52 4e-06
>gnl|LJGI|TC80454 similar to UniRef100_Q2HV76 Cluster: F-box protein interaction
domain; Galactose oxidase, central; n=1; Medicago
truncatula|Rep: F-box protein interaction domain;
Galactose oxidase, central - Medicago truncatula (Barrel
medic), partial (13%)
Length = 1607
Score = 125 bits (63), Expect = 4e-28
Identities = 280/351 (79%), Gaps = 6/351 (1%)
Strand = Plus / Plus
Query: 42 tgtagttctcgcttttgatttggtagaggggagtttattagagattcctatgtcattgca 101
||||||||| |||||||||||||||||| || ||||| | ||||||||| ||||| ||
Sbjct: 750 tgtagttcttgcttttgatttggtagagaggggtttacttgagattcctctgtca---ca 806
Query: 102 tgatttagctgtggaattgggcgatgataacaaagagtatcatttgagggtgatgggagg 161
||||||||| |||||||| ||||||| ||| ||| ||||| ||||| || |||
Sbjct: 807 ggatttagctatggaattgacttatgataagaaaatatattatttgcgggtgctgaaagg 866
Query: 162 gtgtctctgtctgtgtcactcgcgtgtgggt---atggctgaaatatggatgatgatgga 218
|||||| |||||||| ||| || | || ||||| ||||| ||||| |||| ||
Sbjct: 867 atgtctcggtctgtgttgctcaagttttggcggcatggccgaaatgtggataatgaaaga 926
Query: 219 gtataaagtggaatcatcttggactaagattgttttgtcagattacgacttcccttgcaa 278
|||||||||| | || || ||||||| |||||||||||| | || ||| | || | ||
Sbjct: 927 gtataaagtgcagtcgtcgtggactaggattgttttgtcggcttgtgacatttctcggaa 986
Query: 279 ctccttttttccaatatggttcaccaaatgtggtgatatttttggatcaaatgaggttgg 338
|||||||||||| ||||| ||||| ||||| || ||| |||| ||||| || ||| ||||
Sbjct: 987 ctccttttttcctatatgtttcactaaatgcggcgatgttttcggatcgaacgagtttgg 1046
Query: 339 aagattattgaagcttaacgataaaggaaacctgcttgagcatcgcgcact 389
||| || |||| |||||| ||| ||||||| ||||||||||||||||||||
Sbjct: 1047 aaggttgttgaggcttaatgatgaaggaaagctgcttgagcatcgcgcact 1097
>gnl|LJGI|BP044058
Length = 579
Score = 103 bits (52), Expect = 1e-21
Identities = 137/163 (84%), Gaps = 3/163 (1%)
Strand = Plus / Minus
Query: 217 gagtataaagtggaatcatcttggactaagattgttttgtcagattacgacttcccttgc 276
|||||||||||| ||||||||||||||||||||||||| || | | ||| ||| | |
Sbjct: 575 gagtataaagtgcaatcatcttggactaagattgttttctctactcatgacatccatacc 516
Query: 277 -aactcc--ttttttccaatatggttcaccaaatgtggtgatatttttggatcaaatgag 333
||| || |||||||||||||| ||||| ||||||||||| ||||||||||||| | |
Sbjct: 515 naaccccgcttttttccaatatgtttcactaaatgtggtgacatttttggatcaactatg 456
Query: 334 gttggaagattattgaagcttaacgataaaggaaacctgcttg 376
||||||||||||||| || |||||||||||||| |||||||
Sbjct: 455 aatggaagattattgaaactcaacgataaaggaaagctgcttg 413
>gnl|LJGI|TC80159
Length = 748
Score = 101 bits (51), Expect = 5e-21
Identities = 78/87 (89%)
Strand = Plus / Plus
Query: 282 cttttttccaatatggttcaccaaatgtggtgatatttttggatcaaatgaggttggaag 341
||||||||||||||| ||||| |||||||||||| | ||||||||| ||||| |||||||
Sbjct: 165 cttttttccaatatgtttcactaaatgtggtgatgtatttggatcagatgagtttggaag 224
Query: 342 attattgaagcttaacgataaaggaaa 368
|||||||| || ||||||||||||||
Sbjct: 225 attattgagactcaacgataaaggaaa 251
Score = 52.0 bits (26), Expect = 4e-06
Identities = 53/62 (85%)
Strand = Plus / Plus
Query: 404 gggagaggagctatcgtctattatacactcatatgtatacagagagtttactttcactcc 463
||||||| || |||||||||||||| | || ||||||||||| ||| |||| |||||||
Sbjct: 284 gggagagcagatatcgtctattatatagtcgtatgtatacagcaagtatactgtcactcc 343
Query: 464 ct 465
||
Sbjct: 344 ct 345
>gnl|LJGI|FS360686 UniRef100_Q2LTC8 Cluster: Exodeoxyribonuclease V beta chain; n=1;
Syntrophus aciditrophicus SB|Rep:, partial (1%)
Length = 682
Score = 93.7 bits (47), Expect = 1e-18
Identities = 150/182 (82%), Gaps = 3/182 (1%)
Strand = Plus / Minus
Query: 198 tgaaatatggatgatgatggagtataaagtggaatcatcttggactaagattgttttgtc 257
|||||||||||| |||| ||||||||| || ||||||||||||||||||||||||| ||
Sbjct: 518 tgaaatatggataatgaaagagtataaactgcaatcatcttggactaagattgttttctc 459
Query: 258 agattacgacttcccttgca-actcc--ttttttccaatatggttcaccaaatgtggtga 314
| | ||| ||| | ||| || || |||||||||||||| ||||| ||||||||| |
Sbjct: 458 tactcatgacatccttagcacaccccgcttttttccaatatgtttcactaaatgtggtca 399
Query: 315 tatttttggatcaaatgaggttggaagattattgaagcttaacgataaaggaaacctgct 374
||||||||||| |||||| ||||||||| || | | |||||||||||||| |||||
Sbjct: 398 cgtttttggatcagatgaggctggaagattcttcagagtcaacgataaaggaaagctgct 339
Query: 375 tg 376
||
Sbjct: 338 tg 337
>gnl|LJGI|TC60681 similar to UniRef100_A8I1P8 Cluster: Transcriptional regulator;
n=1; Azorhizobium caulinodans ORS 571|Rep:
Transcriptional regulator - Azorhizobium caulinodans
(strain ATCC 43989 / DSM 5975 / ORS 571), partial (6%)
Length = 749
Score = 85.7 bits (43), Expect = 3e-16
Identities = 76/87 (87%)
Strand = Plus / Plus
Query: 290 caatatggttcaccaaatgtggtgatatttttggatcaaatgaggttggaagattattga 349
||||||| ||||| ||||||||||| |||||||||||| ||||| ||||||||||||||
Sbjct: 1 caatatgtttcactaaatgtggtgacatttttggatcagatgagaatggaagattattga 60
Query: 350 agcttaacgataaaggaaacctgcttg 376
| |||||||||||||| |||||||
Sbjct: 61 gattcaacgataaaggaaagctgcttg 87
Score = 54.0 bits (27), Expect = 1e-06
Identities = 45/51 (88%)
Strand = Plus / Plus
Query: 415 tatcgtctattatacactcatatgtatacagagagtttactttcactccct 465
|||||||||||||| | || ||||||||||| |||||||| |||||||||
Sbjct: 111 tatcgtctattatatagtcgtatgtatacagcaagtttactgtcactccct 161
>gnl|LJGI|TC77017 similar to UniRef100_Q2HV76 Cluster: F-box protein interaction
domain; Galactose oxidase, central; n=1; Medicago
truncatula|Rep: F-box protein interaction domain;
Galactose oxidase, central - Medicago truncatula (Barrel
medic), partial (8%)
Length = 1280
Score = 77.8 bits (39), Expect = 8e-14
Identities = 57/63 (90%)
Strand = Plus / Plus
Query: 194 tggctgaaatatggatgatgatggagtataaagtggaatcatcttggactaagattgttt 253
|||||||||||||||| |||| |||||||||||| ||| |||||||||||||||||||
Sbjct: 898 tggctgaaatatggataatgaaagagtataaagtgcgatcgtcttggactaagattgttt 957
Query: 254 tgt 256
|||
Sbjct: 958 tgt 960
>gnl|LJGI|FS360471 UniRef100_Q22HI8 Cluster: Cyclic nucleotide-binding domain
containing protein; n=1; Tetrahymena thermophila SB210|,
partial (0%)
Length = 660
Score = 61.9 bits (31), Expect = 5e-09
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 283 ttttttccaatatggttcaccaaatgtggtgatatttttggatcaaa 329
|||||||||||||| ||||||||| |||||| ||||||||||||||
Sbjct: 393 ttttttccaatatgtttcaccaaacatggtgaaatttttggatcaaa 347
>gnl|LJGI|BP061168
Length = 392
Score = 61.9 bits (31), Expect = 5e-09
Identities = 40/43 (93%)
Strand = Plus / Minus
Query: 607 agtgaagatgatcaacaagcaagtgaagatgaccaacaaccta 649
|||||||||| |||||||||| ||||||||||||||||||||
Sbjct: 145 agtgaagatggccaacaagcaaatgaagatgaccaacaaccta 103
>gnl|LJGI|TC77662
Length = 548
Score = 56.0 bits (28), Expect = 3e-07
Identities = 55/64 (85%)
Strand = Plus / Plus
Query: 403 ggggagaggagctatcgtctattatacactcatatgtatacagagagtttactttcactc 462
|||||||| || ||| |||||||| | | || ||||||||||| ||||||||| ||||||
Sbjct: 97 ggggagagcagatattgtctattacatagtcgtatgtatacagcgagtttactgtcactc 156
Query: 463 cctg 466
||||
Sbjct: 157 cctg 160
>gnl|LJGI|TC81377
Length = 375
Score = 54.0 bits (27), Expect = 1e-06
Identities = 30/31 (96%)
Strand = Plus / Plus
Query: 433 catatgtatacagagagtttactttcactcc 463
||||||||||||||||||||||| |||||||
Sbjct: 3 catatgtatacagagagtttactatcactcc 33
>gnl|LJGI|BP040943
Length = 433
Score = 52.0 bits (26), Expect = 4e-06
Identities = 29/30 (96%)
Strand = Plus / Minus
Query: 437 tgtatacagagagtttactttcactccctg 466
||||||||||||||||||| ||||||||||
Sbjct: 343 tgtatacagagagtttactatcactccctg 314
>gnl|LJGI|AI967342
Length = 435
Score = 52.0 bits (26), Expect = 4e-06
Identities = 48/54 (88%), Gaps = 1/54 (1%)
Strand = Plus / Minus
Query: 193 atggctgaaatatggatgatgatggagtataaagtggaatcatcttggactaag 246
|||||||| ||||||||||||| |||||||||| | | |||||||||||||||
Sbjct: 90 atggctgagatatggatgatgaaagagtataaag-gcactcatcttggactaag 38