Miyakogusa Predicted Gene

Lj1g3v3053740.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3053740.1 tr|Q8LLR2|Q8LLR2_VITVI MADS-box protein 2
OS=Vitis vinifera GN=MADS2 PE=2
SV=1,91.04,8e-29,SRF-like,Transcription factor, MADS-box; no
description,Transcription factor, MADS-box;
SRF-TF,Trans,gene.g34069.t1.1
         (558 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC75219 similar to UniRef100_Q56NI4 Cluster: MADS box p...   371   e-102
gnl|LJGI|TC76874 UniRef100_Q533S8 Cluster: MADS box protein AP1a...   103   1e-21
gnl|LJGI|TC68434 UniRef100_Q533S6 Cluster: MADS box protein SEP3...   103   1e-21
gnl|LJGI|GO024192 similar to UniRef100_Q8LLR1 Cluster: MADS-box ...    84   1e-15
gnl|LJGI|TC67825 UniRef100_Q533S1 Cluster: MADS box protein AGa;...    84   1e-15
gnl|LJGI|TC57459 UniRef100_Q533R8 Cluster: MADS box protein AGL1...    84   1e-15
gnl|LJGI|GO037100 homologue to UniRef100_A0EIX6 Cluster: Transcr...    78   7e-14
gnl|LJGI|TC65119 homologue to UniRef100_Q533R9 Cluster: MADS box...    78   7e-14
gnl|LJGI|BP064158 similar to UniRef100_A7NU52 Cluster: Chromosom...    70   2e-11
gnl|LJGI|TC62447 similar to UniRef100_Q9M725 Cluster: MADS-box t...    66   2e-10
gnl|LJGI|TC60537 similar to UniRef100_Q7Y1U9 Cluster: SVP-like f...    66   2e-10
gnl|LJGI|NP7225997 GB|AY770396.1|AAX13297.1 MADS box protein AP1...    64   1e-09
gnl|LJGI|FS335696 similar to UniRef100_Q67BK3 Cluster: AGL15; n=...    58   6e-08
gnl|LJGI|GO031822 weakly similar to UniRef100_Q9AT62 Cluster: MA...    56   2e-07
gnl|LJGI|TC81268 similar to UniRef100_Q6RF31 Cluster: MADS box t...    56   2e-07

>gnl|LJGI|TC75219 similar to UniRef100_Q56NI4 Cluster: MADS box protein M6; n=1;
           Pisum sativum|Rep: MADS box protein M6 - Pisum sativum
           (Garden pea), complete
          Length = 1276

 Score =  371 bits (187), Expect = e-102
 Identities = 187/187 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggggagaggaagagtggagctgaagaggatagagaacaagataaacaggcaagttaca 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 310 atggggagaggaagagtggagctgaagaggatagagaacaagataaacaggcaagttaca 369

                                                                       
Query: 61  tttgcaaagaggagaaatgggcttctcaagaaagcttatgagctttctgttctctgtgat 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 370 tttgcaaagaggagaaatgggcttctcaagaaagcttatgagctttctgttctctgtgat 429

                                                                       
Query: 121 gctgaggttgctcttattgtcttctccactcgtggcaagctttatgagttttgtagcagc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 430 gctgaggttgctcttattgtcttctccactcgtggcaagctttatgagttttgtagcagc 489

                  
Query: 181 tctagca 187
           |||||||
Sbjct: 490 tctagca 496


>gnl|LJGI|TC76874 UniRef100_Q533S8 Cluster: MADS box protein AP1a; n=1; Lotus
           japonicus|Rep: MADS box protein AP1a - Lotus japonicus,
           complete
          Length = 1382

 Score =  103 bits (52), Expect = 1e-21
 Identities = 109/128 (85%)
 Strand = Plus / Plus

                                                                       
Query: 20  agctgaagaggatagagaacaagataaacaggcaagttacatttgcaaagaggagaaatg 79
           ||||||||||||||||||||||||| ||  |||| || || ||  | || ||||||  ||
Sbjct: 310 agctgaagaggatagagaacaagatcaatcggcaggtaactttctccaaaaggagagctg 369

                                                                       
Query: 80  ggcttctcaagaaagcttatgagctttctgttctctgtgatgctgaggttgctcttattg 139
           ||||||||||||||||| ||||| | ||||||||||| ||||||||||| ||| | ||||
Sbjct: 370 ggcttctcaagaaagctcatgagatctctgttctctgcgatgctgaggtcgctttgattg 429

                   
Query: 140 tcttctcc 147
           ||||||||
Sbjct: 430 tcttctcc 437


>gnl|LJGI|TC68434 UniRef100_Q533S6 Cluster: MADS box protein SEP3; n=1; Lotus
           japonicus|Rep: MADS box protein SEP3 - Lotus japonicus,
           complete
          Length = 1153

 Score =  103 bits (52), Expect = 1e-21
 Identities = 124/148 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggggagaggaagagtggagctgaagaggatagagaacaagataaacaggcaagttaca 60
           ||||||||||||||||||||||||||||| || ||||||||||| ||||||||||| || 
Sbjct: 46  atggggagaggaagagtggagctgaagagaattgagaacaagatcaacaggcaagtgacc 105

                                                                       
Query: 61  tttgcaaagaggagaaatgggcttctcaagaaagcttatgagctttctgttctctgtgat 120
           || || ||  | || || || ||  | |||||||||||||| ||||| ||||| || |||
Sbjct: 106 ttcgctaaacgcaggaacggactattgaagaaagcttatgaactttccgttctttgcgat 165

                                       
Query: 121 gctgaggttgctcttattgtcttctcca 148
           || ||||||||||| ||  |||||||||
Sbjct: 166 gcggaggttgctctcatcatcttctcca 193


>gnl|LJGI|GO024192 similar to UniRef100_Q8LLR1 Cluster: MADS-box protein 3; n=1; Vitis
           vinifera|Rep: MADS-box protein 3 - Vitis vinifera
           (Grape), partial (53%)
          Length = 482

 Score = 83.8 bits (42), Expect = 1e-15
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggggagaggaagagtggagctgaagaggatagagaacaagataaacaggcaagttaca 60
           ||||| ||||| ||||| ||||||||||||||||||||||| || ||| | || ||||| 
Sbjct: 95  atgggtagaggtagagttgagctgaagaggatagagaacaaaatcaaccgccaggttact 154

                                                                       
Query: 61  tttgcaaagaggagaaatgggcttctcaagaaagcttatgagctttctgttctctgtgat 120
           ||  | || ||||| |||||  | ||||||||||| | |||||| ||  |||| ||||||
Sbjct: 155 ttctccaaaaggaggaatggtttgctcaagaaagcatgtgagctctcaattctgtgtgat 214

                         
Query: 121 gctgaggttgctct 134
           ||||||||||||||
Sbjct: 215 gctgaggttgctct 228


>gnl|LJGI|TC67825 UniRef100_Q533S1 Cluster: MADS box protein AGa; n=1; Lotus
           japonicus|Rep: MADS box protein AGa - Lotus japonicus,
           complete
          Length = 1152

 Score = 83.8 bits (42), Expect = 1e-15
 Identities = 66/74 (89%)
 Strand = Plus / Plus

                                                                       
Query: 73  agaaatgggcttctcaagaaagcttatgagctttctgttctctgtgatgctgaggttgct 132
           |||||||| ||||| ||||||||||||||||| ||||| || |||||||| |||||||||
Sbjct: 146 agaaatggccttcttaagaaagcttatgagctatctgtgctttgtgatgcagaggttgct 205

                         
Query: 133 cttattgtcttctc 146
            | |||||||||||
Sbjct: 206 ttgattgtcttctc 219


>gnl|LJGI|TC57459 UniRef100_Q533R8 Cluster: MADS box protein AGL11; n=1; Lotus
           japonicus|Rep: MADS box protein AGL11 - Lotus japonicus,
           complete
          Length = 983

 Score = 83.8 bits (42), Expect = 1e-15
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 67  aagaggagaaatgggcttctcaagaaagcttatgagctttctgttctctgtgatgctgag 126
           ||||| ||||| |||||||| ||||||||||||||||| || || || ||||||||||| 
Sbjct: 150 aagagaagaaacgggcttctgaagaaagcttatgagctatcagtgctgtgtgatgctgaa 209

                                 
Query: 127 gttgctcttattgtcttctcca 148
           ||||| || |||||||||||||
Sbjct: 210 gttgccctcattgtcttctcca 231


>gnl|LJGI|GO037100 homologue to UniRef100_A0EIX6 Cluster: Transcription factor AGL20;
           n=1; Ipomoea batatas|Rep: Transcription factor AGL20 -
           Ipomoea batatas (Sweet potato) (Batate), partial (33%)
          Length = 371

 Score = 77.8 bits (39), Expect = 7e-14
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                       
Query: 65  caaagaggagaaatgggcttctcaagaaagcttatgagctttctgttctctgtgatgctg 124
           |||||||  |||||||| | |||||||| || | ||||||||| ||||| ||||||||||
Sbjct: 211 caaagagacgaaatgggttgctcaagaaggcatttgagctttcagttctgtgtgatgctg 270

                                                      
Query: 125 aggttgctcttattgtcttctccactcgtggcaagctttatga 167
           |||| ||||||||||| |||||  |  |||| |||||||||||
Sbjct: 271 aggtggctcttattgttttctctccaagtgggaagctttatga 313


>gnl|LJGI|TC65119 homologue to UniRef100_Q533R9 Cluster: MADS box protein AGL1; n=1;
           Lotus japonicus|Rep: MADS box protein AGL1 - Lotus
           japonicus, complete
          Length = 1053

 Score = 77.8 bits (39), Expect = 7e-14
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 92  aagcttatgagctttctgttctctgtgatgctgaggttgctcttattgtcttctc 146
           ||||||||||||| |||||||| ||||||||||| |||||||| |||||||||||
Sbjct: 184 aagcttatgagctatctgttctgtgtgatgctgaagttgctctcattgtcttctc 238


>gnl|LJGI|BP064158 similar to UniRef100_A7NU52 Cluster: Chromosome chr18 scaffold_1,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr18 scaffold_1, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (75%)
          Length = 394

 Score = 69.9 bits (35), Expect = 2e-11
 Identities = 59/67 (88%)
 Strand = Plus / Plus

                                                                       
Query: 52  caagttacatttgcaaagaggagaaatgggcttctcaagaaagcttatgagctttctgtt 111
           |||||||| ||  |||||||||| ||||||||  |||||||||||||||| |||||||||
Sbjct: 216 caagttactttctcaaagaggaggaatgggctgatcaagaaagcttatgaactttctgtt 275

                  
Query: 112 ctctgtg 118
           || ||||
Sbjct: 276 ctttgtg 282


>gnl|LJGI|TC62447 similar to UniRef100_Q9M725 Cluster: MADS-box transcription factor;
           n=1; Canavalia lineata|Rep: MADS-box transcription
           factor - Canavalia lineata, partial (72%)
          Length = 820

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 86  tcaagaaagcttatgagctttctgttctctgtgatgctgaggttgctcttattgtcttct 145
           ||||||||||| | |||||||| ||||| |||||||||||||||| | ||||||| ||||
Sbjct: 180 tcaagaaagctcaagagctttcagttctgtgtgatgctgaggttggtattattgtattct 239

            
Query: 146 c 146
           |
Sbjct: 240 c 240


>gnl|LJGI|TC60537 similar to UniRef100_Q7Y1U9 Cluster: SVP-like floral repressor;
           n=1; Eucalyptus occidentalis|Rep: SVP-like floral
           repressor - Eucalyptus occidentalis, partial (94%)
          Length = 1471

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 86  tcaagaaagcttatgagctttctgttctctgtgatgctgaggttgctcttattgtcttct 145
           ||||||||||| | |||||||| ||||||||||||||||| ||||| ||| | |||||||
Sbjct: 613 tcaagaaagctgaagagctttcagttctctgtgatgctgatgttgcccttgtagtcttct 672

            
Query: 146 c 146
           |
Sbjct: 673 c 673


>gnl|LJGI|NP7225997 GB|AY770396.1|AAX13297.1 MADS box protein AP1b;LjAP1b; A function
           protein; includes MADS, I, K, and C domains;
           AP1/SQUA-like
          Length = 1122

 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 88  aagaaagcttatgagctttctgttctctgtgatgctgaggttgctcttattgtcttctcc 147
           ||||||||| ||||| | ||||| || |||||||||||||||||| | ||||||||||||
Sbjct: 167 aagaaagctcatgagatctctgtgctatgtgatgctgaggttgctttgattgtcttctcc 226


>gnl|LJGI|FS335696 similar to UniRef100_Q67BK3 Cluster: AGL15; n=1; Glycine max|Rep:
           AGL15 - Glycine max (Soybean), partial (66%)
          Length = 772

 Score = 58.0 bits (29), Expect = 6e-08
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 48  caggcaagttacatttgcaaagaggagaaatgggcttctcaagaaagcttatgagctttc 107
           ||||||||| |||||  | |||||||||| |||| | |||||||| ||  | |||||  |
Sbjct: 310 caggcaagtcacattctccaagaggagaactgggttgctcaagaaggcaaaggagctagc 369

                                                    
Query: 108 tgttctctgtgatgctgaggttgctcttattgtcttctcca 148
             ||||||||||||||||||||||| ||||  |||||||||
Sbjct: 370 cattctctgtgatgctgaggttgctgttatcatcttctcca 410


>gnl|LJGI|GO031822 weakly similar to UniRef100_Q9AT62 Cluster: MADS box transcription
           factor; n=1; Ipomoea batatas|Rep: MADS box transcription
           factor - Ipomoea batatas (Sweet potato) (Batate),
           partial (41%)
          Length = 520

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 49  aggcaagttacatttgcaaagaggagaaatgggcttctcaagaaagct 96
           |||||||| |||||  ||||||||||||| |||||| |||||||||||
Sbjct: 143 aggcaagtgacattctcaaagaggagaaaagggcttttcaagaaagct 190


>gnl|LJGI|TC81268 similar to UniRef100_Q6RF31 Cluster: MADS box transcription factor;
           n=1; Populus tomentosa|Rep: MADS box transcription
           factor - Populus tomentosa (Chinese white poplar),
           partial (46%)
          Length = 773

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 49  aggcaagttacatttgcaaagaggagaaatgggcttctcaagaaagct 96
           |||||||| |||||  ||||||||||||| |||||| |||||||||||
Sbjct: 158 aggcaagtgacattctcaaagaggagaaaagggcttttcaagaaagct 205