Miyakogusa Predicted Gene

Lj1g3v3023700.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3023700.1 CUFF.29899.1
         (313 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV771539 similar to UniRef100_A4NXC9 Cluster: Nicotinam...    68   3e-11

>gnl|LJGI|AV771539 similar to UniRef100_A4NXC9 Cluster: Nicotinamide-nucleotide
           adenylyltransferase; n=1; Haemophilus influenzae
           22.4-21|Rep: Nicotinamide-nucleotide adenylyltransferase
           - Haemophilus influenzae 22.4-21, partial (8%)
          Length = 410

 Score = 67.9 bits (34), Expect = 3e-11
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 126 ccctttctctctcccagtcgcaaatttgtggaagcttcatctcctc 171
           ||||||||||||||| ||||||||| | ||||||||||||||||||
Sbjct: 323 ccctttctctctccctgtcgcaaatctttggaagcttcatctcctc 278