Miyakogusa Predicted Gene

Lj1g3v3020970.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3020970.1 Non Chatacterized Hit- tr|I1MIG9|I1MIG9_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,63.64,0.000000000006,DUF3403,S-locus receptor kinase,
C-terminal,CUFF.29871.1
         (169 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC65334 similar to UniRef100_A7P186 Cluster: Chromosome...    62   1e-09

>gnl|LJGI|TC65334 similar to UniRef100_A7P186 Cluster: Chromosome chr19 scaffold_4,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr19 scaffold_4, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (34%)
          Length = 1193

 Score = 61.9 bits (31), Expect = 1e-09
 Identities = 64/75 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtcttctgtggttctattgctgaatggtgagaaattactgccacaaccaaaagttccg 60
           ||||| || ||||||||| |||| |||||||||||| || ||||| | ||||| ||||| 
Sbjct: 774 atgtcatccgtggttctaatgctaaatggtgagaaactattgccaaagccaaaggttcct 833

                          
Query: 61  ggtttttatactgaa 75
           || ||||||||||||
Sbjct: 834 ggcttttatactgaa 848