Miyakogusa Predicted Gene
- Lj1g3v2738180.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v2738180.1 Non Chatacterized Hit- tr|I1N3T3|I1N3T3_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,77.15,0,seg,NULL;
FERRIC-CHELATE REDUCTASE,NULL; NADPH OXIDASE,NULL; Ferredoxin
reductase-like, C-terminal
N,NODE_8918_length_1477_cov_7.553148.path2.1
(1221 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP067009 similar to UniRef100_Q6T303 Cluster: Ferric re... 460 e-128
gnl|LJGI|TC62636 similar to UniRef100_Q6T303 Cluster: Ferric red... 123 3e-27
>gnl|LJGI|BP067009 similar to UniRef100_Q6T303 Cluster: Ferric reductase; n=1; Medicago
truncatula|Rep: Ferric reductase - Medicago truncatula
(Barrel medic), partial (10%)
Length = 496
Score = 460 bits (232), Expect = e-128
Identities = 234/235 (99%)
Strand = Plus / Minus
Query: 987 gattcatgaaatagatagagaattggaaagcctaccacttcaacaatttgctcaagttac 1046
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 496 gattcatgaaatagatagagaattggaaagcctaccacttcaacaatttgctcaagttac 437
Query: 1047 aaatgtgcattatggtgtaagacctgatctaagaagactaatatctgaactgaatgggtc 1106
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 436 aaatgtgcattatggtgtaagacctgatctaagaagactaatatctgaactgaatgggtc 377
Query: 1107 aactgtgggagttcttgcttctgggcccaagaaaatgagacaggaggttgcagccatttg 1166
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 376 aactgtgggagttcttgcttctgggcccnagaaaatgagacaggaggttgcagccatttg 317
Query: 1167 ctcatctggttcagctgaaaatctgcattttgagtccttaagctttacgtggtaa 1221
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 316 ctcatctggttcagctgaaaatctgcattttgagtccttaagctttacgtggtaa 262
>gnl|LJGI|TC62636 similar to UniRef100_Q6T303 Cluster: Ferric reductase; n=1; Medicago
truncatula|Rep: Ferric reductase - Medicago truncatula
(Barrel medic), partial (22%)
Length = 773
Score = 123 bits (62), Expect = 3e-27
Identities = 140/166 (84%)
Strand = Plus / Plus
Query: 1048 aatgtgcattatggtgtaagacctgatctaagaagactaatatctgaactgaatgggtca 1107
||||||||||||||||||||||| ||||||| || ||| ||| |||| | || ||||||
Sbjct: 287 aatgtgcattatggtgtaagaccagatctaaaaaaactgctatttgaagtcaaagggtca 346
Query: 1108 actgtgggagttcttgcttctgggcccaagaaaatgagacaggaggttgcagccatttgc 1167
| |||||||||| | ||| || ||||| || |||| || ||||||||||||||||||
Sbjct: 347 agtgtgggagttgccgtttcaggacccaaacaattgaggcatgaggttgcagccatttgc 406
Query: 1168 tcatctggttcagctgaaaatctgcattttgagtccttaagcttta 1213
|||||||||| ||||||||| || |||||||||||| | |||||||
Sbjct: 407 tcatctggtttagctgaaaaccttcattttgagtccatcagcttta 452
Score = 99.6 bits (50), Expect = 4e-20
Identities = 155/190 (81%)
Strand = Plus / Plus
Query: 770 taattggggtcattacccattacttcattttccctgtggatcataattcaaacaaaatat 829
|||||||| ||||||| | ||||| |||||||||| |||||||||||||||||| |||
Sbjct: 3 taattgggatcattacacgttactacattttccctaccgatcataattcaaacaaagtat 62
Query: 830 tttcataccctctgaagtctttcctcaatatgtcaacaatgtttgtgtccatagccatgg 889
| ||||| || ||| | | ||||| || ||| | ||||| |||||||||||| | |
Sbjct: 63 tctcatattctatgagggcgttccttaacatgctagtaatgtgtgtgtccatagcaactg 122
Query: 890 ctgctagtgcagctgttctatggaacaagaaacacaatgacaaagaagaagagcagattc 949
||||||| ||||||||||| |||||||||||||| |||| |||||| | | ||| |||
Sbjct: 123 ctgctagcgcagctgttctttggaacaagaaacaaaatgctaaagaaacaaaacaggttc 182
Query: 950 agaacttgga 959
||||||||||
Sbjct: 183 agaacttgga 192