Miyakogusa Predicted Gene

Lj1g3v2628750.2
Show Alignment:  
BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v2628750.2 tr|Q9LLR0|Q9LLR0_SOYBN Carboxyl transferase alpha
subunit OS=Glycine max GN=accA-1 PE=3 SV=1,33.33,2e-18,seg,NULL;
coiled-coil,NULL,CUFF.29363.2
         (1044 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BG662353                                                     258   6e-68

>gnl|LJGI|BG662353 
          Length = 395

 Score =  258 bits (130), Expect = 6e-68
 Identities = 130/130 (100%)
 Strand = Plus / Plus

                                                                        
Query: 915  agagaggattcttgctgcattggatgttacagcactgaatgagaaaattgagagactgag 974
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1    agagaggattcttgctgcattggatgttacagcactgaatgagaaaattgagagactgag 60

                                                                        
Query: 975  ggaggaggtgaagtcctcatccaagggagtttctggaaacaagattggcatggaaaatgg 1034
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61   ggaggaggtgaagtcctcatccaagggagtttctggaaacaagattggcatggaaaatgg 120

                      
Query: 1035 tagatggtga 1044
            ||||||||||
Sbjct: 121  tagatggtga 130