Miyakogusa Predicted Gene

Lj1g3v2626160.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v2626160.2 tr|G7KL97|G7KL97_MEDTR Pentatricopeptide
repeat-containing protein OS=Medicago truncatula
GN=MTR_6g0,25.34,2e-18,PPR: pentatricopeptide repeat
domain,Pentatricopeptide repeat; no
description,Tetratricopeptide-like,CUFF.29316.2
         (1616 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC82599 weakly similar to UniRef100_A7PJG0 Cluster: Chr...    60   5e-08
gnl|LJGI|BP047039 weakly similar to UniRef100_Q1SMZ4 Cluster: Te...    58   2e-07
gnl|LJGI|GO037297 weakly similar to UniRef100_A7Q622 Cluster: Ch...    54   3e-06

>gnl|LJGI|TC82599 weakly similar to UniRef100_A7PJG0 Cluster: Chromosome chr12
            scaffold_18, whole genome shotgun sequence; n=1; Vitis
            vinifera|Rep: Chromosome chr12 scaffold_18, whole genome
            shotgun sequence - Vitis vinifera (Grape), partial (13%)
          Length = 1411

 Score = 60.0 bits (30), Expect = 5e-08
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                      
Query: 1482 tatgatgaatgggctttgtaaagagggtttacttgatgaagc 1523
            |||||| |||||||||||||||||||||||  ||||||||||
Sbjct: 136  tatgatcaatgggctttgtaaagagggtttgtttgatgaagc 177


>gnl|LJGI|BP047039 weakly similar to UniRef100_Q1SMZ4 Cluster: Tetratricopeptide-like
            helical; n=1; Medicago truncatula|Rep:
            Tetratricopeptide-like helical - Medicago truncatula
            (Barrel medic), partial (9%)
          Length = 527

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 1471 acatataacactatgatgaatgggctttgtaaagagggtttacttgatgaagc 1523
            |||||||| |||||||| ||||| |||||||||||||| ||  ||||||||||
Sbjct: 489  acatataatactatgatcaatggactttgtaaagagggcttgtttgatgaagc 437


>gnl|LJGI|GO037297 weakly similar to UniRef100_A7Q622 Cluster: Chromosome chr14
           scaffold_54, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr14 scaffold_54, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (18%)
          Length = 537

 Score = 54.0 bits (27), Expect = 3e-06
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 529 tatgggacattgatcaatgggttgtgtaaaa 559
           |||||||| ||||||||||||||||||||||
Sbjct: 79  tatgggaccttgatcaatgggttgtgtaaaa 109