Miyakogusa Predicted Gene

Lj1g3v2584620.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v2584620.1 Non Chatacterized Hit- tr|I1K7Y4|I1K7Y4_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.44729
PE,72.92,0.0000000000003,NAD(P)-binding Rossmann-fold domains,NULL;
DTDP-GLUCOSE 4,6-DEHYDRATASE,NULL; NAD DEPENDENT
EPIMERAS,BW623410.path2.1
         (177 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW617252                                                     297   1e-80
gnl|LJGI|TC72998                                                      297   1e-80
gnl|LJGI|TC72196                                                      297   1e-80
gnl|LJGI|BW623410                                                     289   3e-78
gnl|LJGI|FS345145                                                     264   2e-70

>gnl|LJGI|BW617252 
          Length = 483

 Score =  297 bits (150), Expect = 1e-80
 Identities = 150/150 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaacaaggtattggtcaccggagcaaccggttacctcggaggaaggctctgtcacgcg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 50  atgaacaaggtattggtcaccggagcaaccggttacctcggaggaaggctctgtcacgcg 109

                                                                       
Query: 61  cttctccgacaaggttactccgtcaggatcctcgccagacgcaccagcgatctctccgcc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 110 cttctccgacaaggttactccgtcaggatcctcgccagacgcaccagcgatctctccgcc 169

                                         
Query: 121 cttccaccgccttccgagatcttctacggc 150
           ||||||||||||||||||||||||||||||
Sbjct: 170 cttccaccgccttccgagatcttctacggc 199


>gnl|LJGI|TC72998 
          Length = 575

 Score =  297 bits (150), Expect = 1e-80
 Identities = 150/150 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaacaaggtattggtcaccggagcaaccggttacctcggaggaaggctctgtcacgcg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 186 atgaacaaggtattggtcaccggagcaaccggttacctcggaggaaggctctgtcacgcg 245

                                                                       
Query: 61  cttctccgacaaggttactccgtcaggatcctcgccagacgcaccagcgatctctccgcc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 246 cttctccgacaaggttactccgtcaggatcctcgccagacgcaccagcgatctctccgcc 305

                                         
Query: 121 cttccaccgccttccgagatcttctacggc 150
           ||||||||||||||||||||||||||||||
Sbjct: 306 cttccaccgccttccgagatcttctacggc 335


>gnl|LJGI|TC72196 
          Length = 483

 Score =  297 bits (150), Expect = 1e-80
 Identities = 150/150 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaacaaggtattggtcaccggagcaaccggttacctcggaggaaggctctgtcacgcg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 19  atgaacaaggtattggtcaccggagcaaccggttacctcggaggaaggctctgtcacgcg 78

                                                                       
Query: 61  cttctccgacaaggttactccgtcaggatcctcgccagacgcaccagcgatctctccgcc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 79  cttctccgacaaggttactccgtcaggatcctcgccagacgcaccagcgatctctccgcc 138

                                         
Query: 121 cttccaccgccttccgagatcttctacggc 150
           ||||||||||||||||||||||||||||||
Sbjct: 139 cttccaccgccttccgagatcttctacggc 168


>gnl|LJGI|BW623410 
          Length = 487

 Score =  289 bits (146), Expect = 3e-78
 Identities = 149/150 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaacaaggtattggtcaccggagcaaccggttacctcggaggaaggctctgtcacgcg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 155 atgaacaaggtattggtcaccggagcaaccggttacctcggaggaaggctctgtcacgcg 214

                                                                       
Query: 61  cttctccgacaaggttactccgtcaggatcctcgccagacgcaccagcgatctctccgcc 120
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 215 cttctccgacaaggttactccgtcaggatcctcgccagacgcaccagcgatctctctgcc 274

                                         
Query: 121 cttccaccgccttccgagatcttctacggc 150
           ||||||||||||||||||||||||||||||
Sbjct: 275 cttccaccgccttccgagatcttctacggc 304


>gnl|LJGI|FS345145 
          Length = 621

 Score =  264 bits (133), Expect = 2e-70
 Identities = 133/133 (100%)
 Strand = Plus / Plus

                                                                       
Query: 18  caccggagcaaccggttacctcggaggaaggctctgtcacgcgcttctccgacaaggtta 77
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   caccggagcaaccggttacctcggaggaaggctctgtcacgcgcttctccgacaaggtta 60

                                                                       
Query: 78  ctccgtcaggatcctcgccagacgcaccagcgatctctccgcccttccaccgccttccga 137
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctccgtcaggatcctcgccagacgcaccagcgatctctccgcccttccaccgccttccga 120

                        
Query: 138 gatcttctacggc 150
           |||||||||||||
Sbjct: 121 gatcttctacggc 133