Miyakogusa Predicted Gene

Lj1g3v2394320.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v2394320.1 Non Chatacterized Hit- tr|I1L765|I1L765_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,81.42,0,no
description,Protein phosphatase 2C-like; Serine/threonine
phosphatases, family 2C, ca,Protein pho,CUFF.28988.1
         (1308 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO020316 weakly similar to UniRef100_A7QFG6 Cluster: Ch...    56   6e-07

>gnl|LJGI|GO020316 weakly similar to UniRef100_A7QFG6 Cluster: Chromosome chr8
           scaffold_88, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr8 scaffold_88, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (8%)
          Length = 617

 Score = 56.0 bits (28), Expect = 6e-07
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 632 accaacttgttcctgttcaacttactgttgacttgaaaccagatcttccaggtgaa 687
           |||| ||| |||| ||||||||||||||||||||||  |||||| ||||| |||||
Sbjct: 345 accatcttattccggttcaacttactgttgacttgatcccagatattccaagtgaa 400