Miyakogusa Predicted Gene

Lj1g3v2377980.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v2377980.1 tr|K0H6H6|K0H6H6_SOYBN DRE-binding protein 2D2
OS=Glycine max GN=DREB2D;2 PE=2 SV=1,60.04,0,ETHRSPELEMNT,AP2/ERF
domain; seg,NULL; DNA-binding domain in plant proteins such as,AP2/ERF
domain; ,CUFF.28968.1
         (1581 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC75377 similar to UniRef100_A4F249 Cluster: Wound-resp...    56   7e-07

>gnl|LJGI|TC75377 similar to UniRef100_A4F249 Cluster: Wound-responsive AP2 like
           factor 2; n=1; Nicotiana tabacum|Rep: Wound-responsive
           AP2 like factor 2 - Nicotiana tabacum (Common tobacco),
           partial (19%)
          Length = 434

 Score = 56.0 bits (28), Expect = 7e-07
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 228 caggggcgtgaggcagaggatttgggggaagtgggttgctgagattcgcgaaccga 283
           |||||| |||||||||||   ||||||||| |||| ||||||||||||||| ||||
Sbjct: 349 caggggagtgaggcagagaccttgggggaaatgggctgctgagattcgcgacccga 404