Miyakogusa Predicted Gene

Lj1g3v2372290.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v2372290.1 tr|K1QMT1|K1QMT1_CRAGI DnaJ-like protein
subfamily B member 4 OS=Crassostrea gigas PE=4
SV=1,44.35,2e-18,DNAJ_2,Heat shock protein DnaJ, N-terminal; FAMILY
NOT NAMED,NULL; JDOMAIN,Heat shock protein DnaJ; ,CUFF.28932.1
         (1719 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS343402 weakly similar to UniRef100_Q6CRN5 Cluster: Kl...   967   0.0  

>gnl|LJGI|FS343402 weakly similar to UniRef100_Q6CRN5 Cluster: Kluyveromyces lactis
           strain NRRL Y-1140 chromosome D of strain NRRL Y- 1140
           of Kluyveromyces lactis; n=1; Kluyveromyces lactis|Rep:
           Kluyveromyces lactis strain NRRL Y-1140 chromosome D of
           strain NRRL Y- 1140 of Kluyveromyces lactis -
           Kluyveromyces lactis (Yeast) (Candida sphaerica),
           partial (16%)
          Length = 598

 Score =  967 bits (488), Expect = 0.0
 Identities = 488/488 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgagaacccgttcaaccaccacatgggtcatcctcgtggccacactgtatttcctcgcc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 51  atgagaacccgttcaaccaccacatgggtcatcctcgtggccacactgtatttcctcgcc 110

                                                                       
Query: 61  agcttctttgaatcggaagccaaaaccatagacccctacaaggttcttggggttgataaa 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 111 agcttctttgaatcggaagccaaaaccatagacccctacaaggttcttggggttgataaa 170

                                                                       
Query: 121 aatgcaggtcagcgagaaattcagaaggctttccacaagctctctcttcagtatcaccct 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 171 aatgcaggtcagcgagaaattcagaaggctttccacaagctctctcttcagtatcaccct 230

                                                                       
Query: 181 gacaagaacaaaagcaaaggtgcacaagagaagttttcgcagatcaataatgcgtatgag 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 231 gacaagaacaaaagcaaaggtgcacaagagaagttttcgcagatcaataatgcgtatgag 290

                                                                       
Query: 241 attttatccgatgaagagaagaggaagaattatgacttgtatggagatgaaaaaggaaat 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 291 attttatccgatgaagagaagaggaagaattatgacttgtatggagatgaaaaaggaaat 350

                                                                       
Query: 301 cctggatttgatgctggccatcctggaggtttcacagggggtggtcctggacaaaacaat 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 351 cctggatttgatgctggccatcctggaggtttcacagggggtggtcctggacaaaacaat 410

                                                                       
Query: 361 tttaacttcagaccaggggactggcagggtgggcaaggaggatctaactcattctccttt 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 411 tttaacttcagaccaggggactggcagggtgggcaaggaggatctaactcattctccttt 470

                                                                       
Query: 421 tccttcggcggctcaggcaattcaaatccttttgggttcgggttagatgatctttttggc 480
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 471 tccttcggcggctcaggcaattcaaatccttttgggttcgggttagatgatctttttggc 530

                   
Query: 481 agtttttt 488
           ||||||||
Sbjct: 531 agtttttt 538