Miyakogusa Predicted Gene
- Lj1g3v2300730.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v2300730.1 Non Chatacterized Hit- tr|I1KKB1|I1KKB1_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,84.76,0,no
description,Homeodomain-like; Homeodomain-like,Homeodomain-like;
SUBFAMILY NOT NAMED,NULL; FAMILY,CUFF.28841.1
(495 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC80644 similar to UniRef100_Q66RN1 Cluster: MYB transc... 971 0.0
gnl|LJGI|GO010963 similar to UniRef100_Q0PJL5 Cluster: MYB trans... 117 7e-26
gnl|LJGI|GO012661 similar to UniRef100_Q0PJJ2 Cluster: MYB trans... 62 3e-09
gnl|LJGI|TC71658 similar to UniRef100_Q0PJK8 Cluster: MYB transc... 62 3e-09
gnl|LJGI|TC60861 similar to UniRef100_Q0PJK8 Cluster: MYB transc... 56 2e-07
>gnl|LJGI|TC80644 similar to UniRef100_Q66RN1 Cluster: MYB transcription factor; n=1;
Hevea brasiliensis|Rep: MYB transcription factor - Hevea
brasiliensis (Para rubber tree), partial (79%)
Length = 1931
Score = 971 bits (490), Expect = 0.0
Identities = 490/490 (100%)
Strand = Plus / Plus
Query: 1 atgaataggggagttgaagttctctctccagcctcctatctccacaattccaattggttg 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 722 atgaataggggagttgaagttctctctccagcctcctatctccacaattccaattggttg 781
Query: 61 ttccaggaaagtaaaggagccaaatggactccacaagagaacaagctgtttgagaatgct 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 782 ttccaggaaagtaaaggagccaaatggactccacaagagaacaagctgtttgagaatgct 841
Query: 121 ttggcttatttcgataaggacaccccggatcgatggttgagggtggcatcgatgattcca 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 842 ttggcttatttcgataaggacaccccggatcgatggttgagggtggcatcgatgattcca 901
Query: 181 gggaaaactgtgggtgatgtgatcaaacagtacaaggaacttgaagaggatgtgtgtgtc 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 902 gggaaaactgtgggtgatgtgatcaaacagtacaaggaacttgaagaggatgtgtgtgtc 961
Query: 241 attgaagcaggtttggtcccagttcctgggtatggtgctgattctttcacattggagtgg 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 962 attgaagcaggtttggtcccagttcctgggtatggtgctgattctttcacattggagtgg 1021
Query: 301 gctaacaatcatcagggctatgatattgatgatgggttcaagcaattttatagtgttggt 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1022 gctaacaatcatcagggctatgatattgatgatgggttcaagcaattttatagtgttggt 1081
Query: 361 gggaaaaggggtgcatcatgtactcggccatctgaacaggaaaggaaaaaaggagtgcca 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1082 gggaaaaggggtgcatcatgtactcggccatctgaacaggaaaggaaaaaaggagtgcca 1141
Query: 421 tggactgaagaggaacacaggctatttctgctgggtctgaagaagtatggtaaaggggat 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1142 tggactgaagaggaacacaggctatttctgctgggtctgaagaagtatggtaaaggggat 1201
Query: 481 tggagaaaca 490
||||||||||
Sbjct: 1202 tggagaaaca 1211
>gnl|LJGI|GO010963 similar to UniRef100_Q0PJL5 Cluster: MYB transcription factor
MYB57; n=1; Glycine max|Rep: MYB transcription factor
MYB57 - Glycine max (Soybean), partial (46%)
Length = 569
Score = 117 bits (59), Expect = 7e-26
Identities = 89/99 (89%)
Strand = Plus / Plus
Query: 392 ctgaacaggaaaggaaaaaaggagtgccatggactgaagaggaacacaggctatttctgc 451
|||| ||||||||||| ||||| ||||||||||||||||||||||||| | | |||||||
Sbjct: 436 ctgatcaggaaaggaagaaaggtgtgccatggactgaagaggaacacaagttgtttctgc 495
Query: 452 tgggtctgaagaagtatggtaaaggggattggagaaaca 490
|||||||||| |||||||| ||||| |||||||| ||||
Sbjct: 496 tgggtctgaaaaagtatggcaaaggagattggaggaaca 534
Score = 83.8 bits (42), Expect = 9e-16
Identities = 141/174 (81%)
Strand = Plus / Plus
Query: 96 agagaacaagctgtttgagaatgctttggcttatttcgataaggacaccccggatcgatg 155
|||||||||||||||||| |||||| | || | |||||||||||||||||||| ||
Sbjct: 155 agagaacaagctgtttgaaaatgctcttgcagtgtatgataaggacaccccggatcggtg 214
Query: 156 gttgagggtggcatcgatgattccagggaaaactgtgggtgatgtgatcaaacagtacaa 215
|| |||||||| |||||| ||||| ||||| || | |||||||| || ||||||||
Sbjct: 215 gtacagggtggctgagatgataccaggaaaaacagttgtggatgtgataaagcagtacaa 274
Query: 216 ggaacttgaagaggatgtgtgtgtcattgaagcaggtttggtcccagttcctgg 269
|||| | |||| |||||| ||| ||| ||||| || ||||||||| |||||||
Sbjct: 275 ggaattggaagtggatgtttgtaacatagaagctgggttggtcccaattcctgg 328
>gnl|LJGI|GO012661 similar to UniRef100_Q0PJJ2 Cluster: MYB transcription factor
MYB109; n=1; Glycine max|Rep: MYB transcription factor
MYB109 - Glycine max (Soybean), partial (63%)
Length = 702
Score = 61.9 bits (31), Expect = 3e-09
Identities = 82/99 (82%)
Strand = Plus / Plus
Query: 389 catctgaacaggaaaggaaaaaaggagtgccatggactgaagaggaacacaggctatttc 448
|||| ||||| ||||||||||||||| | || ||||| |||||||| |||||| |||||
Sbjct: 463 catcagaacaagaaaggaaaaaaggaattccttggacagaagaggagcacaggttatttt 522
Query: 449 tgctgggtctgaagaagtatggtaaaggggattggagaa 487
| || || || | |||| ||| ||||||||||||||||
Sbjct: 523 tacttggcctagacaagtttgggaaaggggattggagaa 561
>gnl|LJGI|TC71658 similar to UniRef100_Q0PJK8 Cluster: MYB transcription factor
MYB75; n=1; Glycine max|Rep: MYB transcription factor
MYB75 - Glycine max (Soybean), partial (80%)
Length = 1397
Score = 61.9 bits (31), Expect = 3e-09
Identities = 97/119 (81%)
Strand = Plus / Plus
Query: 133 gataaggacaccccggatcgatggttgagggtggcatcgatgattccagggaaaactgtg 192
||||||||||| || ||| ||||| ||| ||||| | |||||||| ||||| ||||||
Sbjct: 506 gataaggacacaccagatagatggctgaatgtggctgcaatgattcctgggaagactgtg 565
Query: 193 ggtgatgtgatcaaacagtacaaggaacttgaagaggatgtgtgtgtcattgaagcagg 251
|||||||||||| ||||||| |||| | ||||| ||||| ||| |||||||||||
Sbjct: 566 cttgatgtgatcaagcagtacagggaattggaagaagatgtaggtgaaattgaagcagg 624
>gnl|LJGI|TC60861 similar to UniRef100_Q0PJK8 Cluster: MYB transcription factor
MYB75; n=1; Glycine max|Rep: MYB transcription factor
MYB75 - Glycine max (Soybean), partial (45%)
Length = 793
Score = 56.0 bits (28), Expect = 2e-07
Identities = 73/88 (82%)
Strand = Plus / Plus
Query: 403 aggaaaaaaggagtgccatggactgaagaggaacacaggctatttctgctgggtctgaag 462
||||| ||||| || || ||||| |||||||||||||| |||||| |||| || |
Sbjct: 492 aggaagaaaggggtcccctggaccgaagaggaacacagaggctttctgatgggacttcaa 551
Query: 463 aagtatggtaaaggggattggagaaaca 490
|||||||||| |||||||||||||||||
Sbjct: 552 aagtatggtataggggattggagaaaca 579