Miyakogusa Predicted Gene

Lj1g3v2139680.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v2139680.1 Non Chatacterized Hit- tr|I1JT73|I1JT73_SOYBN
Uncharacterized protein OS=Glycine max PE=3
SV=1,76.81,0,THIOL_PROTEASE_CYS,Cysteine peptidase, cysteine active
site; THIOL_PROTEASE_HIS,Cysteine peptidase, ,CUFF.28591.1
         (1269 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC78549 similar to UniRef100_O24321 Cluster: Cysteine p...    54   2e-06

>gnl|LJGI|TC78549 similar to UniRef100_O24321 Cluster: Cysteine proteinase precursor;
           n=1; Phaseolus vulgaris|Rep: Cysteine proteinase
           precursor - Phaseolus vulgaris (Kidney bean) (French
           bean), partial (50%)
          Length = 941

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 54/63 (85%)
 Strand = Plus / Plus

                                                                       
Query: 866 ttgtaggatatggttctgaaaatggagtagattattggattttgaagaactcatggggaa 925
           |||| |||||||| |||||||||||   |||||||||| |  ||| ||||||||||||||
Sbjct: 372 ttgttggatatggctctgaaaatggtaaagattattggctagtgaggaactcatggggaa 431

              
Query: 926 ctc 928
           |||
Sbjct: 432 ctc 434