Miyakogusa Predicted Gene

Lj1g3v2127240.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v2127240.1 Non Chatacterized Hit- tr|C0JP24|C0JP24_LOTJA
Putative basic helix-loop-helix protein BHLH6 OS=Lotus,44.21,0.000003,
,gene.Ljchr1_pseudomol_20120830.path1.gene5072.1
         (535 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO018918 UniRef100_Q6J9H4 Cluster: SET binding protein ...    60   1e-08

>gnl|LJGI|GO018918 UniRef100_Q6J9H4 Cluster: SET binding protein 1; n=1; Gorilla
           gorilla|Rep: SET binding protein 1 - Gorilla gorilla
           (gorilla), partial (5%)
          Length = 600

 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 96/118 (81%)
 Strand = Plus / Plus

                                                                       
Query: 395 ctgggggttacttcactagggcgactaaagcatggattttggggaaatctgtgggtttgc 454
           |||||||||||||||| ||||| || || |||||| | ||||| ||||| |  ||| | |
Sbjct: 306 ctgggggttacttcaccagggcaacaaaggcatggttattgggtaaatcagctggtcttc 365

                                                                     
Query: 455 gctatccagggagtgacgaagaagctataaggggcttggctgaagaactagaagaaga 512
           | ||||| |||| ||| || ||||| |||||||||||||| || ||| | ||||||||
Sbjct: 366 gttatccggggactgatgaggaagcaataaggggcttggcagaggaattggaagaaga 423