Miyakogusa Predicted Gene

Lj1g3v2063070.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v2063070.1 Non Chatacterized Hit- tr|I1MJK0|I1MJK0_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,48.94,4,seg,NULL,CUFF.28348.1
         (271 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72430 similar to UniRef100_Q9SPB9 Cluster: Ubiquitin ...    64   5e-10

>gnl|LJGI|TC72430 similar to UniRef100_Q9SPB9 Cluster: Ubiquitin carrier protein;
           n=1; Glycine max|Rep: Ubiquitin carrier protein -
           Glycine max (Soybean), partial (30%)
          Length = 990

 Score = 63.9 bits (32), Expect = 5e-10
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 162 tctccctcctccacttccagtctcagatctgcttggaggtggagtggg 209
           |||| |||||||||||| ||| |||||||||| |||||||||||||||
Sbjct: 184 tctctctcctccacttctagtttcagatctgcgtggaggtggagtggg 231