Miyakogusa Predicted Gene
- Lj1g3v2038790.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v2038790.1 tr|G7ZWL9|G7ZWL9_MEDTR C-myb-like transcription
factor OS=Medicago truncatula GN=MTR_042s0013 PE=4
S,76.56,2e-18,Myb_DNA-binding,SANT/Myb domain; no
description,Homeodomain-like; HTH_MYB,Myb domain;
Homeodomain-li,CUFF.28605.1
(207 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|DC592860 similar to UniRef100_Q948S5 Cluster: Myb; n=1;... 319 4e-87
>gnl|LJGI|DC592860 similar to UniRef100_Q948S5 Cluster: Myb; n=1; Nicotiana
tabacum|Rep: Myb - Nicotiana tabacum (Common tobacco),
partial (8%)
Length = 576
Score = 319 bits (161), Expect = 4e-87
Identities = 175/180 (97%)
Strand = Plus / Plus
Query: 1 atggaaggtgaaaggttaacccctgctccatcggagggaaccgtggacggtgttcagaaa 60
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 309 atggaaggtgaaaggtcaacccctgctccatcggagggaaccgtggacggtgttcagaaa 368
Query: 61 attagagcgctgcatgggaggactactgggccaacaagacggtctactaaaggacaatgg 120
|||||||| || |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 369 attagagctctatatgggaggactactgggccaacaagacggtctactaaaggacaatgg 428
Query: 121 actcctgaggaggatgagattttgcggaatgctgttcatcgttttaaagggaagaattgg 180
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 429 actcctgaggaggatgagattttgcggaatgctgttcatcgttttanagggaagaattgg 488