Miyakogusa Predicted Gene

Lj1g3v2035180.4
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v2035180.4 Non Chatacterized Hit- tr|I1K978|I1K978_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.55494
PE,80.56,0.0000000006,seg,NULL,CUFF.28303.4
         (381 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS326902 similar to UniRef100_Q0JHX2 Cluster: Os01g0837...   212   1e-54

>gnl|LJGI|FS326902 similar to UniRef100_Q0JHX2 Cluster: Os01g0837900 protein; n=2;
           Oryza sativa Japonica Group|Rep: Os01g0837900 protein -
           Oryza sativa subsp. japonica (Rice), partial (38%)
          Length = 767

 Score =  212 bits (107), Expect = 1e-54
 Identities = 107/107 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcttgagattgatgtgcttgaacgtctaacaaagaaggatggagcaagctcacgctgt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 518 atgcttgagattgatgtgcttgaacgtctaacaaagaaggatggagcaagctcacgctgt 577

                                                          
Query: 61  gtgcagatcataaattggtttgattaccgaaatcacatatgcattgt 107
           |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 578 gtgcagatcataaattggtttgattaccgaaatcacatatgcattgt 624