Miyakogusa Predicted Gene
- Lj1g3v1914950.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v1914950.1 CUFF.28128.1
(408 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC74241 homologue to UniRef100_A7P5K0 Cluster: Histone ... 809 0.0
gnl|LJGI|TC63189 homologue to UniRef100_A5AKG7 Cluster: Histone ... 258 2e-68
gnl|LJGI|TC81273 homologue to UniRef100_A7P5K0 Cluster: Histone ... 172 1e-42
gnl|LJGI|TC60753 homologue to UniRef100_Q8H7Y8 Cluster: Probable... 153 1e-36
gnl|LJGI|TC63694 homologue to UniRef100_Q8H7Y8 Cluster: Probable... 111 3e-24
gnl|LJGI|TC59007 homologue to UniRef100_Q8H7Y8 Cluster: Probable... 111 3e-24
>gnl|LJGI|TC74241 homologue to UniRef100_A7P5K0 Cluster: Histone H2A; n=1; Vitis
vinifera|Rep: Histone H2A - Vitis vinifera (Grape),
complete
Length = 757
Score = 809 bits (408), Expect = 0.0
Identities = 408/408 (100%)
Strand = Plus / Plus
Query: 1 atgtcagggaaaggtgccaagggattgataacagggaagacccccgcttccgccaaggac 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 134 atgtcagggaaaggtgccaagggattgataacagggaagacccccgcttccgccaaggac 193
Query: 61 aaggacaagaagaaagccgtttctcgctcctcccgagctggtcttcagttccccgttgga 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 194 aaggacaagaagaaagccgtttctcgctcctcccgagctggtcttcagttccccgttgga 253
Query: 121 cgaattcaccgtcttctgaaatcgagggccactgccagcggaagagttggggccaccgct 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 254 cgaattcaccgtcttctgaaatcgagggccactgccagcggaagagttggggccaccgct 313
Query: 181 gcggtatacgctgctgcgattctcgagtatttgacggcggaggttttggagctggctggg 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 314 gcggtatacgctgctgcgattctcgagtatttgacggcggaggttttggagctggctggg 373
Query: 241 aatgcgagcaaggatctgaaggtgaagcgaattacccctaggcatttgcagctggccatt 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 374 aatgcgagcaaggatctgaaggtgaagcgaattacccctaggcatttgcagctggccatt 433
Query: 301 cgcggagatgaagaacttgatacgctcatcaaagggacgattgcgggcggtggtgttatt 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 434 cgcggagatgaagaacttgatacgctcatcaaagggacgattgcgggcggtggtgttatt 493
Query: 361 cctcatattcacaagtctctgatcaataaatcttccaaggaatgagtg 408
||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 494 cctcatattcacaagtctctgatcaataaatcttccaaggaatgagtg 541
>gnl|LJGI|TC63189 homologue to UniRef100_A5AKG7 Cluster: Histone H2A; n=2; core
eudicotyledons|Rep: Histone H2A - Vitis vinifera
(Grape), partial (89%)
Length = 690
Score = 258 bits (130), Expect = 2e-68
Identities = 289/342 (84%)
Strand = Plus / Plus
Query: 65 acaagaagaaagccgtttctcgctcctcccgagctggtcttcagttccccgttggacgaa 124
||||||||||| || ||||| || ||| ||||||||||||||||||| ||||||||||
Sbjct: 114 acaagaagaaacccacctctcgttcttccagagctggtcttcagttccctgttggacgaa 173
Query: 125 ttcaccgtcttctgaaatcgagggccactgccagcggaagagttggggccaccgctgcgg 184
|||||||||||||||| | |||| | || | |||||||||||||| || ||||| |
Sbjct: 174 ttcaccgtcttctgaagacaagggtgtcggcgaatggaagagttggggcaacagctgcag 233
Query: 185 tatacgctgctgcgattctcgagtatttgacggcggaggttttggagctggctgggaatg 244
| ||| ||||||| || || ||||| || || |||||||| |||||| |||| || ||||
Sbjct: 234 tttacactgctgctatcctggagtacttaactgcggaggtgttggagttggccggcaatg 293
Query: 245 cgagcaaggatctgaaggtgaagcgaattacccctaggcatttgcagctggccattcgcg 304
||||||||||||||||||||||||| |||||||| || ||| | ||||| || || ||||
Sbjct: 294 cgagcaaggatctgaaggtgaagcgcattaccccaagacatcttcagcttgcaatccgcg 353
Query: 305 gagatgaagaacttgatacgctcatcaaagggacgattgcgggcggtggtgttattcctc 364
|||| |||||||| ||||| ||||||||||| || || || || ||||||||||||||||
Sbjct: 354 gagacgaagaactagataccctcatcaaaggaactatagctggtggtggtgttattcctc 413
Query: 365 atattcacaagtctctgatcaataaatcttccaaggaatgag 406
|||| ||||||||||| ||||| |||||||| ||||||||||
Sbjct: 414 atatccacaagtctcttatcaacaaatcttcaaaggaatgag 455
>gnl|LJGI|TC81273 homologue to UniRef100_A7P5K0 Cluster: Histone H2A; n=1; Vitis
vinifera|Rep: Histone H2A - Vitis vinifera (Grape),
partial (90%)
Length = 475
Score = 172 bits (87), Expect = 1e-42
Identities = 270/331 (81%)
Strand = Plus / Plus
Query: 54 caaggacaaggacaagaagaaagccgtttctcgctcctcccgagctggtcttcagttccc 113
|||||||||||||||||||||| || |||||| || ||||| || ||||||||||| ||
Sbjct: 145 caaggacaaggacaagaagaaacccacttctcgttcttcccgtgccggtcttcagtttcc 204
Query: 114 cgttggacgaattcaccgtcttctgaaatcgagggccactgccagcggaagagttggggc 173
|||||| | || ||||| ||| |||| || || |||| || || ||||| || ||
Sbjct: 205 ggttggaaggatccaccggcttttgaagtcaagaaccacggctcatggtagagtgggagc 264
Query: 174 caccgctgcggtatacgctgctgcgattctcgagtatttgacggcggaggttttggagct 233
||| ||||| || ||| ||||||| || | |||||| |||| || || || ||||||||
Sbjct: 265 cacggctgctgtctactctgctgctatcttggagtatctgactgctgaagtattggagct 324
Query: 234 ggctgggaatgcgagcaaggatctgaaggtgaagcgaattacccctaggcatttgcagct 293
|||||||||||| ||||||||||| ||||| ||||| ||||| || |||||| | || ||
Sbjct: 325 ggctgggaatgctagcaaggatctcaaggttaagcgtattactcccaggcatctacaact 384
Query: 294 ggccattcgcggagatgaagaacttgatacgctcatcaaagggacgattgcgggcggtgg 353
|| || ||||| ||||||||||| |||||||| || ||||| || ||||| || || ||
Sbjct: 385 tgctatccgcggtgatgaagaactggatacgctgattaaaggaacaattgctggaggagg 444
Query: 354 tgttattcctcatattcacaagtctctgatc 384
||||||||||||||||||||| |||||||||
Sbjct: 445 tgttattcctcatattcacaaatctctgatc 475
>gnl|LJGI|TC60753 homologue to UniRef100_Q8H7Y8 Cluster: Probable histone H2A variant
1; n=3; Oryza sativa|Rep: Probable histone H2A variant 1
- Oryza sativa subsp. japonica (Rice), partial (98%)
Length = 766
Score = 153 bits (77), Expect = 1e-36
Identities = 149/173 (86%)
Strand = Plus / Plus
Query: 233 tggctgggaatgcgagcaaggatctgaaggtgaagcgaattacccctaggcatttgcagc 292
||||||||||||||||||||||| ||||||||||| | || || ||||||||||||||||
Sbjct: 332 tggctgggaatgcgagcaaggatttgaaggtgaagaggataactcctaggcatttgcagc 391
Query: 293 tggccattcgcggagatgaagaacttgatacgctcatcaaagggacgattgcgggcggtg 352
| || || | |||||||| || |||||||| || ||||||||||| ||||| || ||||
Sbjct: 392 ttgctatcaggggagatgaggagcttgataccctgatcaaagggactattgctggtggtg 451
Query: 353 gtgttattcctcatattcacaagtctctgatcaataaatcttccaaggaatga 405
|||| |||||||| ||||||||||| ||||||| ||| || |||||||||||
Sbjct: 452 gtgtcattcctcacattcacaagtccttgatcaacaaaactgccaaggaatga 504
>gnl|LJGI|TC63694 homologue to UniRef100_Q8H7Y8 Cluster: Probable histone H2A variant
1; n=3; Oryza sativa|Rep: Probable histone H2A variant 1
- Oryza sativa subsp. japonica (Rice), partial (92%)
Length = 732
Score = 111 bits (56), Expect = 3e-24
Identities = 134/160 (83%)
Strand = Plus / Plus
Query: 227 tggagctggctgggaatgcgagcaaggatctgaaggtgaagcgaattacccctaggcatt 286
||||||||||||||||||| ||||||||||||||||||||| | || || || | || |
Sbjct: 315 tggagctggctgggaatgcaagcaaggatctgaaggtgaagaggatcacaccgcgtcact 374
Query: 287 tgcagctggccattcgcggagatgaagaacttgatacgctcatcaaagggacgattgcgg 346
||||||| || || | ||||||||||| ||||| || ||||||||||| || ||||| |
Sbjct: 375 tgcagctcgctatcaggggagatgaagagcttgacaccctcatcaaaggaaccattgctg 434
Query: 347 gcggtggtgttattcctcatattcacaagtctctgatcaa 386
| |||||||| || ||||| ||||||||||| |||||||
Sbjct: 435 gtggtggtgtcatccctcacattcacaagtccttgatcaa 474
>gnl|LJGI|TC59007 homologue to UniRef100_Q8H7Y8 Cluster: Probable histone H2A variant
1; n=3; Oryza sativa|Rep: Probable histone H2A variant 1
- Oryza sativa subsp. japonica (Rice), partial (92%)
Length = 789
Score = 111 bits (56), Expect = 3e-24
Identities = 134/160 (83%)
Strand = Plus / Plus
Query: 227 tggagctggctgggaatgcgagcaaggatctgaaggtgaagcgaattacccctaggcatt 286
||||||||||||||||||| ||||||||||||||||||||| | || || || | || |
Sbjct: 279 tggagctggctgggaatgcaagcaaggatctgaaggtgaagaggatcacaccgcgtcact 338
Query: 287 tgcagctggccattcgcggagatgaagaacttgatacgctcatcaaagggacgattgcgg 346
||||||| || || | ||||||||||| ||||| || ||||||||||| || ||||| |
Sbjct: 339 tgcagctcgctatcaggggagatgaagagcttgacaccctcatcaaaggaaccattgctg 398
Query: 347 gcggtggtgttattcctcatattcacaagtctctgatcaa 386
| |||||||| || ||||| ||||||||||| |||||||
Sbjct: 399 gtggtggtgtcatccctcacattcacaagtccttgatcaa 438