Miyakogusa Predicted Gene

Lj1g3v1819840.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v1819840.1 Non Chatacterized Hit- tr|C6T5R2|C6T5R2_SOYBN
Putative uncharacterized protein OS=Glycine max PE=2
S,79.17,0.005,seg,NULL,CUFF.29099.1
         (379 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC73948 similar to UniRef100_Q93ZE8 Cluster: Stromal ce...   141   4e-33

>gnl|LJGI|TC73948 similar to UniRef100_Q93ZE8 Cluster: Stromal cell-derived factor
           2-like protein precursor; n=2; Arabidopsis thaliana|Rep:
           Stromal cell-derived factor 2-like protein precursor -
           Arabidopsis thaliana (Mouse-ear cress), partial (96%)
          Length = 1254

 Score =  141 bits (71), Expect = 4e-33
 Identities = 71/71 (100%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgagaatgcaaccggaatttcgtcttctcgtgcataagcttcaaaacggatccataagt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 496 atgagaatgcaaccggaatttcgtcttctcgtgcataagcttcaaaacggatccataagt 437

                      
Query: 61  aacctgcacct 71
           |||||||||||
Sbjct: 436 aacctgcacct 426



 Score =  139 bits (70), Expect = 1e-32
 Identities = 70/70 (100%)
 Strand = Plus / Minus

                                                                       
Query: 310 aatgcgatgaaccagttttgctgccagatcggaaactccgattccgagcgggttctcgat 369
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 288 aatgcgatgaaccagttttgctgccagatcggaaactccgattccgagcgggttctcgat 229

                     
Query: 370 tcccggtaaa 379
           ||||||||||
Sbjct: 228 tcccggtaaa 219