Miyakogusa Predicted Gene

Lj1g3v1810100.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v1810100.1 tr|I5CJV9|I5CJV9_9BURK Zinc-binding
oxidoreductase OS=Burkholderia terrae BS001 PE=4 SV=1,44.68,1.1,
,CUFF.27989.1
         (250 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC82639 homologue to UniRef100_A7PMS9 Cluster: Chromoso...   178   1e-44
gnl|LJGI|DC595217 similar to UniRef100_Q0IL14 Cluster: p6.9; n=1...   139   9e-33
gnl|LJGI|BP065342 similar to UniRef100_A9V1F4 Cluster: Predicted...   129   9e-30
gnl|LJGI|TC75336 weakly similar to UniRef100_A9YLY1 Cluster: NAD...    80   7e-15
gnl|LJGI|GO026384 homologue to UniRef100_Q8W0V0 Cluster: Type II...    64   4e-10

>gnl|LJGI|TC82639 homologue to UniRef100_A7PMS9 Cluster: Chromosome chr14
           scaffold_21, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr14 scaffold_21, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (55%)
          Length = 874

 Score =  178 bits (90), Expect = 1e-44
 Identities = 102/106 (96%)
 Strand = Plus / Plus

                                                                       
Query: 54  ggtggtggtgttgcggctgttgtggcccgcagctggacaaggggaggtggtcgtgactcg 113
           |||||||||| |||||||||||||||| |||||||||||| |||||||||||||||||||
Sbjct: 26  ggtggtggtgctgcggctgttgtggccagcagctggacaatgggaggtggtcgtgactcg 85

                                                         
Query: 114 cggtggcgcagccatgggagaggagctcgtgtggttgttgtgggtt 159
           |||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 86  cggtggtgcagccatgggagaggagctcgtgtggttgttgtgggtt 131


>gnl|LJGI|DC595217 similar to UniRef100_Q0IL14 Cluster: p6.9; n=1; Leucania separata
           nuclear polyhedrosis virus|Rep: p6.9 - Leucania separata
           nuclear polyhedrosis virus (LsNPV), partial (15%)
          Length = 474

 Score =  139 bits (70), Expect = 9e-33
 Identities = 79/82 (96%)
 Strand = Plus / Plus

                                                                       
Query: 86  ctggacaaggggaggtggtcgtgactcgcggtggcgcagccatgggagaggagctcgtgt 145
           |||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 23  ctggacaaggggaggtggtcgtgacttgcggtggtgcagccatgggagaggagctcgtgt 82

                                 
Query: 146 ggttgttgtgggttcgtggtgg 167
           ||||||||||||| ||||||||
Sbjct: 83  ggttgttgtgggtccgtggtgg 104


>gnl|LJGI|BP065342 similar to UniRef100_A9V1F4 Cluster: Predicted protein; n=1;
           Monosiga brevicollis MX1|Rep: Predicted protein -
           Monosiga brevicollis MX1, partial (4%)
          Length = 475

 Score =  129 bits (65), Expect = 9e-30
 Identities = 68/69 (98%)
 Strand = Plus / Plus

                                                                       
Query: 99  ggtggtcgtgactcgcggtggcgcagccatgggagaggagctcgtgtggttgttgtgggt 158
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 211 ggtggtcgtgactcgcggtggtgcagccatgggagaggagctcgtgtggttgttgtgggt 270

                    
Query: 159 tcgtggtgg 167
           |||||||||
Sbjct: 271 tcgtggtgg 279


>gnl|LJGI|TC75336 weakly similar to UniRef100_A9YLY1 Cluster: NADH dehydrogenase
           subunit 4; n=1; Ectyoplasia ferox|Rep: NADH
           dehydrogenase subunit 4 - Ectyoplasia ferox, partial
           (4%)
          Length = 518

 Score = 79.8 bits (40), Expect = 7e-15
 Identities = 50/52 (96%), Gaps = 1/52 (1%)
 Strand = Plus / Minus

                                                               
Query: 194 tagctttttcttgcgttttttgttggtctggtatgaactggatttggaatgg 245
           |||||||||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 391 tagctttttcttgcgttttt-gttggtctggtatggactggatttggaatgg 341


>gnl|LJGI|GO026384 homologue to UniRef100_Q8W0V0 Cluster: Type IIB calcium ATPase;
           n=1; Medicago truncatula|Rep: Type IIB calcium ATPase -
           Medicago, partial (1%)
          Length = 623

 Score = 63.9 bits (32), Expect = 4e-10
 Identities = 48/52 (92%), Gaps = 1/52 (1%)
 Strand = Plus / Plus

                                                               
Query: 194 tagctttttcttgcgttttttgttggtctggtatgaactggatttggaatgg 245
           ||||||||||||||||||||| ||||||| ||||| ||| ||||||||||||
Sbjct: 395 tagctttttcttgcgtttttt-ttggtcttgtatggactagatttggaatgg 445