Miyakogusa Predicted Gene
- Lj1g3v1786020.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v1786020.1 Non Chatacterized Hit- tr|Q21JX8|Q21JX8_SACD2
Putative uncharacterized protein OS=Saccharophagus
deg,25.97,6e-19,Ceramidase,Ceramidase; seg,NULL,CUFF.27839.1
(816 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO012833 84 2e-15
>gnl|LJGI|GO012833
Length = 474
Score = 83.8 bits (42), Expect = 2e-15
Identities = 60/66 (90%)
Strand = Plus / Plus
Query: 678 tgtaagtaagtacgttatcagtgggcattctttggaacacttgtgcttagcgctgattcc 737
||||| ||| |||||||||||||||||||||| |||||||||||||||||| ||||| ||
Sbjct: 117 tgtaaataactacgttatcagtgggcattcttcggaacacttgtgcttagcactgatccc 176
Query: 738 aatttt 743
| ||||
Sbjct: 177 attttt 182